Incidental Mutation 'R2263:Olfr1378'
ID243932
Institutional Source Beutler Lab
Gene Symbol Olfr1378
Ensembl Gene ENSMUSG00000050343
Gene Nameolfactory receptor 1378
SynonymsGA_x6K02T2QP88-4469162-4468215, MOR129-2
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50966530-50973113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50969869 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 284 (V284I)
Ref Sequence ENSEMBL: ENSMUSP00000149432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052285] [ENSMUST00000213259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052285
AA Change: V284I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058119
Gene: ENSMUSG00000050343
AA Change: V284I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.1e-54 PFAM
Pfam:7tm_1 41 289 1.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213259
AA Change: V284I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Olfr1378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Olfr1378 APN 11 50969119 missense probably benign 0.00
PIT4243001:Olfr1378 UTSW 11 50969552 missense probably damaging 1.00
R0540:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0607:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0699:Olfr1378 UTSW 11 50969818 missense probably damaging 1.00
R0719:Olfr1378 UTSW 11 50969934 nonsense probably null
R2117:Olfr1378 UTSW 11 50969320 missense probably damaging 0.98
R3402:Olfr1378 UTSW 11 50969068 missense probably benign
R3767:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3768:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3769:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R4293:Olfr1378 UTSW 11 50969426 missense probably damaging 1.00
R4409:Olfr1378 UTSW 11 50969396 missense probably damaging 1.00
R4446:Olfr1378 UTSW 11 50969863 missense probably damaging 1.00
R4731:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4732:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4733:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R5437:Olfr1378 UTSW 11 50969108 missense probably benign 0.02
R6085:Olfr1378 UTSW 11 50969123 missense probably damaging 1.00
R6648:Olfr1378 UTSW 11 50969173 missense probably damaging 1.00
R7419:Olfr1378 UTSW 11 50969325 nonsense probably null
R7686:Olfr1378 UTSW 11 50969755 missense possibly damaging 0.92
X0011:Olfr1378 UTSW 11 50969654 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTATATTCTCTCCAATGTGCTG -3'
(R):5'- GTGTGGCACTTAAAGATGGC -3'

Sequencing Primer
(F):5'- GCTGAAGTTCCCATCTATTCAGGG -3'
(R):5'- TGGCAACATGAGTAAGAAATACAATC -3'
Posted On2014-10-16