Incidental Mutation 'R2263:Uqcrfs1'
ID243946
Institutional Source Beutler Lab
Gene Symbol Uqcrfs1
Ensembl Gene ENSMUSG00000038462
Gene Nameubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms4430402G14Rik
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location30540308-30545362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30541107 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 150 (S150L)
Ref Sequence ENSEMBL: ENSMUSP00000045284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042834]
Predicted Effect probably benign
Transcript: ENSMUST00000042834
AA Change: S150L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000045284
Gene: ENSMUSG00000038462
AA Change: S150L

DomainStartEndE-ValueType
Pfam:Ubiq-Cytc-red_N 2 77 6.4e-30 PFAM
Pfam:UCR_TM 80 145 1.3e-33 PFAM
Pfam:Rieske 176 268 5.6e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mutant mice harboring a 3' UTR insertion that reduces expression specifically in skin acquire dark patches in the dorsal brown coat at 4-7 months of age. In heterozygotes, the dark patches eventually fill the entire dorsal region; in homozygotes, the dark patches eventually turn grey. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Uqcrfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Uqcrfs1 APN 13 30540925 missense probably benign 0.14
IGL01318:Uqcrfs1 APN 13 30540921 missense probably benign 0.15
IGL01603:Uqcrfs1 APN 13 30541198 missense probably benign
IGL02016:Uqcrfs1 APN 13 30545114 missense probably benign
IGL02740:Uqcrfs1 APN 13 30541023 missense probably damaging 1.00
R0142:Uqcrfs1 UTSW 13 30540942 missense probably benign 0.26
R0266:Uqcrfs1 UTSW 13 30541163 missense probably benign 0.17
R1457:Uqcrfs1 UTSW 13 30540907 missense probably damaging 1.00
R1469:Uqcrfs1 UTSW 13 30540801 missense probably damaging 1.00
R1469:Uqcrfs1 UTSW 13 30540801 missense probably damaging 1.00
R2079:Uqcrfs1 UTSW 13 30541308 missense probably benign 0.19
R2134:Uqcrfs1 UTSW 13 30540804 missense probably benign 0.22
R2262:Uqcrfs1 UTSW 13 30541107 missense probably benign 0.01
R4324:Uqcrfs1 UTSW 13 30541158 missense probably benign 0.35
R4963:Uqcrfs1 UTSW 13 30540763 missense probably damaging 1.00
R5783:Uqcrfs1 UTSW 13 30545204 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTGCAATGGGTACACAAC -3'
(R):5'- ACTATCGTCGTGCTGAAGTTC -3'

Sequencing Primer
(F):5'- AAGATGAGTACAGACACCTATCAG -3'
(R):5'- CGTGCTGAAGTTCTTGATAGCAC -3'
Posted On2014-10-16