Incidental Mutation 'R2263:Utp15'
ID243947
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene NameUTP15 small subunit processome component
Synonyms
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location98246845-98263041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98257925 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 153 (N153S)
Ref Sequence ENSEMBL: ENSMUSP00000048204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040972]
Predicted Effect probably benign
Transcript: ENSMUST00000040972
AA Change: N153S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: N153S

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225100
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0125:Utp15 UTSW 13 98250882 missense possibly damaging 0.81
R0679:Utp15 UTSW 13 98259403 missense probably benign 0.13
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R3888:Utp15 UTSW 13 98259166 missense probably benign 0.00
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5436:Utp15 UTSW 13 98260846 unclassified probably null
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R6489:Utp15 UTSW 13 98250609 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCTCACTACAACCTGACATC -3'
(R):5'- AGACACTTTCTGTTTTCTGCAG -3'

Sequencing Primer
(F):5'- AGGCTAGTGCTCTACCACTAATGG -3'
(R):5'- CAGAGATGACTTCACTCAGTGAGTC -3'
Posted On2014-10-16