Incidental Mutation 'R2263:Cryl1'
ID243949
Institutional Source Beutler Lab
Gene Symbol Cryl1
Ensembl Gene ENSMUSG00000021947
Gene Namecrystallin, lambda 1
SynonymsA230106J09Rik, 1110025H08Rik
MMRRC Submission 040263-MU
Accession Numbers

Genbank: NM_030004; Ensembl: ENSMUST00000089502

Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57274993-57398529 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 57286408 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 232 (Y232*)
Ref Sequence ENSEMBL: ENSMUSP00000022517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022517]
Predicted Effect probably null
Transcript: ENSMUST00000022517
AA Change: Y232*
SMART Domains Protein: ENSMUSP00000022517
Gene: ENSMUSG00000021947
AA Change: Y232*

DomainStartEndE-ValueType
Pfam:3HCDH_N 8 190 3.4e-53 PFAM
Pfam:3HCDH 192 282 8.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223986
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The uronate cycle functions as an alternative glucose metabolic pathway, accounting for about 5% of daily glucose catabolism. The product of this gene catalyzes the dehydrogenation of L-gulonate into dehydro-L-gulonate in the uronate cycle. The enzyme requires NAD(H) as a coenzyme, and is inhibited by inorganic phosphate. A similar gene in the rabbit is thought to serve a structural role in the lens of the eye. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Cryl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Cryl1 APN 14 57286364 critical splice donor site probably null
IGL02117:Cryl1 APN 14 57286447 missense probably damaging 1.00
IGL02556:Cryl1 APN 14 57276021 missense probably benign 0.00
IGL02749:Cryl1 APN 14 57303724 missense probably benign 0.03
IGL03108:Cryl1 APN 14 57313077 missense probably damaging 1.00
G5030:Cryl1 UTSW 14 57342138 intron probably benign
R0391:Cryl1 UTSW 14 57303775 missense possibly damaging 0.94
R2087:Cryl1 UTSW 14 57275945 missense possibly damaging 0.84
R2155:Cryl1 UTSW 14 57398423 missense unknown
R2913:Cryl1 UTSW 14 57275918 missense probably benign 0.19
R2914:Cryl1 UTSW 14 57275918 missense probably benign 0.19
R4747:Cryl1 UTSW 14 57313102 missense probably damaging 1.00
R5482:Cryl1 UTSW 14 57313012 missense probably damaging 0.99
R5977:Cryl1 UTSW 14 57382779 missense probably benign 0.02
R6792:Cryl1 UTSW 14 57382767 missense probably damaging 0.97
R7134:Cryl1 UTSW 14 57275499 missense probably benign
R7409:Cryl1 UTSW 14 57286385 missense probably damaging 1.00
R7522:Cryl1 UTSW 14 57275971 missense probably benign
R7653:Cryl1 UTSW 14 57303691 missense probably benign 0.01
R7711:Cryl1 UTSW 14 57275556 missense probably benign 0.01
R7785:Cryl1 UTSW 14 57275481 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTACTAGGGTTGATCAGAGTCCC -3'
(R):5'- AGCTTGGTTGTACAAAATCCG -3'

Sequencing Primer
(F):5'- GATCAGAGTCCCTTCTAGGCACTG -3'
(R):5'- CCTTTCCAAAGAGCTCAC -3'
Posted On2014-10-16