Mutagenetix > Incidental Mutation

Incidental Mutation 'R2263:Fbxl3'

243951

Institutional Source

Beutler Lab

Gene Symbol

Fbxl3

Ensembl Gene

ENSMUSG00000022124

Gene Name

F-box and leucine-rich repeat protein 3

Synonyms

Fbxl3a, Play68, Ovtm, Fbl3a

MMRRC Submission

040263-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R2263 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103317675-103337002 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 103320648 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 314 (Y314*)

Ref Sequence

ENSEMBL: ENSMUSP00000116044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022720] [ENSMUST00000132004] [ENSMUST00000145693]

AlphaFold

Q8C4V4

Predicted Effect

probably null
Transcript: ENSMUST00000022720
AA Change: Y314*

SMART Domains

Protein: ENSMUSP00000022720
Gene: ENSMUSG00000022124
AA Change: Y314*

Domain	Start	End	E-Value	Type
FBOX	39	79	5.92e-7	SMART
low complexity region	235	247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127113

Predicted Effect

probably null
Transcript: ENSMUST00000132004
AA Change: Y266*

SMART Domains

Protein: ENSMUSP00000115843
Gene: ENSMUSG00000022124
AA Change: Y266*

Domain	Start	End	E-Value	Type
FBOX	39	79	2.46e-4	SMART
low complexity region	187	199	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000145693
AA Change: Y314*

SMART Domains

Protein: ENSMUSP00000116044
Gene: ENSMUSG00000022124
AA Change: Y314*

Domain	Start	End	E-Value	Type
FBOX	39	79	5.92e-7	SMART
low complexity region	235	247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226952

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats and is localized in the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both heterozygous and homozygous mutant mice display a longer free running period than that of wild-type mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,224,702 (GRCm39)	S472P	probably benign	Het
Armh3	A	G	19: 45,920,788 (GRCm39)		probably null	Het
Arsi	T	C	18: 61,049,737 (GRCm39)	Y207H	probably damaging	Het
Atp2b4	C	T	1: 133,654,271 (GRCm39)	R778Q	probably benign	Het
Bdp1	T	A	13: 100,202,545 (GRCm39)	D693V	probably damaging	Het
Car12	C	A	9: 66,654,913 (GRCm39)	Y114*	probably null	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Col4a1	A	G	8: 11,362,586 (GRCm39)		probably benign	Het
Cryl1	G	T	14: 57,523,865 (GRCm39)	Y232*	probably null	Het
Dnah11	T	A	12: 117,843,760 (GRCm39)	M4362L	probably benign	Het
Dnah11	T	C	12: 117,930,374 (GRCm39)	T3324A	probably damaging	Het
Dnah8	A	G	17: 30,892,809 (GRCm39)	N798S	probably damaging	Het
Dok4	A	T	8: 95,593,140 (GRCm39)	C182S	probably damaging	Het
Ehbp1	A	T	11: 22,045,462 (GRCm39)	N737K	probably benign	Het
Eif2b4	T	C	5: 31,349,918 (GRCm39)		probably benign	Het
Elp1	A	G	4: 56,755,298 (GRCm39)		probably null	Het
Fat4	T	C	3: 38,943,138 (GRCm39)	V677A	possibly damaging	Het
Fbn2	A	G	18: 58,228,248 (GRCm39)		probably benign	Het
Fgf12	T	A	16: 28,008,363 (GRCm39)	K84*	probably null	Het
Flt3	G	A	5: 147,284,873 (GRCm39)	P748L	probably benign	Het
Folh1	C	T	7: 86,368,973 (GRCm39)	S685N	probably benign	Het
Gpr65	A	T	12: 98,241,494 (GRCm39)	N49I	probably damaging	Het
Hdac7	A	G	15: 97,708,732 (GRCm39)		probably null	Het
Heatr5a	A	T	12: 51,962,933 (GRCm39)	V989E	probably damaging	Het
Kif12	A	G	4: 63,087,758 (GRCm39)	S242P	probably benign	Het
Ltbp3	G	A	19: 5,804,050 (GRCm39)	R854Q	probably benign	Het
Mia3	A	G	1: 183,115,647 (GRCm39)	Y295H	probably benign	Het
Nell1	C	T	7: 50,210,569 (GRCm39)	T494I	possibly damaging	Het
Nmur2	A	T	11: 55,920,387 (GRCm39)	V286E	probably damaging	Het
Or1ad6	G	A	11: 50,860,696 (GRCm39)	V284I	possibly damaging	Het
Or1e1	T	A	11: 73,245,131 (GRCm39)	L184Q	possibly damaging	Het
Or51t4	T	C	7: 102,598,464 (GRCm39)	F254S	probably damaging	Het
Pcdh1	A	T	18: 38,331,710 (GRCm39)	L431H	probably benign	Het
Pramel31	A	G	4: 144,090,111 (GRCm39)	I384V	probably benign	Het
Prex1	A	T	2: 166,430,988 (GRCm39)		probably benign	Het
Prim1	T	A	10: 127,851,132 (GRCm39)	D5E	probably benign	Het
Rubcnl	A	T	14: 75,278,260 (GRCm39)	N348I	possibly damaging	Het
Shisa9	G	T	16: 11,802,631 (GRCm39)	A63S	possibly damaging	Het
Shpk	G	A	11: 73,097,319 (GRCm39)		probably benign	Het
Slx4ip	T	C	2: 136,885,935 (GRCm39)	I85T	probably damaging	Het
Sptbn4	T	A	7: 27,133,782 (GRCm39)	D77V	probably damaging	Het
Strn3	A	T	12: 51,690,006 (GRCm39)		probably null	Het
Synrg	T	C	11: 83,867,978 (GRCm39)	M61T	possibly damaging	Het
Tekt4	T	A	17: 25,695,485 (GRCm39)	S439R	possibly damaging	Het
Ticam1	A	T	17: 56,578,888 (GRCm39)	V69E	possibly damaging	Het
Trpv1	C	T	11: 73,132,508 (GRCm39)	A374V	probably damaging	Het
Ubqln3	A	T	7: 103,790,842 (GRCm39)	L416*	probably null	Het
Uqcrfs1	G	A	13: 30,725,090 (GRCm39)	S150L	probably benign	Het
Utp15	T	C	13: 98,394,433 (GRCm39)	N153S	probably benign	Het
Vmn2r63	G	T	7: 42,578,031 (GRCm39)	T169N	probably benign	Het
Vps13b	T	A	15: 35,646,327 (GRCm39)	V1477E	probably benign	Het
Wdr87-ps	T	C	7: 29,231,987 (GRCm39)		noncoding transcript	Het
Xpo1	T	A	11: 23,234,634 (GRCm39)		probably null	Het
Xpo5	A	G	17: 46,541,269 (GRCm39)	I769V	probably benign	Het
Zc3h14	A	T	12: 98,724,773 (GRCm39)	H252L	probably benign	Het
Zfp410	G	T	12: 84,369,794 (GRCm39)		probably null	Het
Zfp521	T	C	18: 13,979,297 (GRCm39)	E372G	possibly damaging	Het

Other mutations in Fbxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Fbxl3	APN	14	103,332,730 (GRCm39)	missense	probably damaging	1.00
IGL01981:Fbxl3	APN	14	103,332,900 (GRCm39)	missense	possibly damaging	0.79
IGL03208:Fbxl3	APN	14	103,320,376 (GRCm39)	nonsense	probably null
delargo	UTSW	14	103,326,854 (GRCm39)	missense	probably damaging	1.00
PIT4403001:Fbxl3	UTSW	14	103,332,900 (GRCm39)	missense	possibly damaging	0.79
R0282:Fbxl3	UTSW	14	103,332,661 (GRCm39)	missense	probably damaging	1.00
R0462:Fbxl3	UTSW	14	103,320,322 (GRCm39)	missense	probably damaging	1.00
R0710:Fbxl3	UTSW	14	103,326,751 (GRCm39)	missense	probably damaging	1.00
R1075:Fbxl3	UTSW	14	103,332,839 (GRCm39)	missense	probably benign	0.00
R4239:Fbxl3	UTSW	14	103,326,854 (GRCm39)	missense	probably damaging	1.00
R4362:Fbxl3	UTSW	14	103,329,749 (GRCm39)	missense	probably damaging	1.00
R4497:Fbxl3	UTSW	14	103,320,313 (GRCm39)	missense	probably damaging	1.00
R4585:Fbxl3	UTSW	14	103,320,526 (GRCm39)	missense	probably damaging	0.99
R4586:Fbxl3	UTSW	14	103,320,526 (GRCm39)	missense	probably damaging	0.99
R5347:Fbxl3	UTSW	14	103,320,730 (GRCm39)	missense	probably damaging	0.97
R5349:Fbxl3	UTSW	14	103,333,012 (GRCm39)	intron	probably benign
R5885:Fbxl3	UTSW	14	103,320,667 (GRCm39)	missense	probably benign	0.06
R6744:Fbxl3	UTSW	14	103,320,730 (GRCm39)	missense	probably damaging	0.99
R8314:Fbxl3	UTSW	14	103,326,876 (GRCm39)	missense	probably benign	0.04
R9015:Fbxl3	UTSW	14	103,329,790 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGGCACTACATGAGACTTCAC -3'
(R):5'- TCGCACTGTCTTCTGAAAAGC -3'

Sequencing Primer
(F):5'- GGCACTACATGAGACTTCACATTCC -3'
(R):5'- CGCTTAGAACATTTGCGCATTG -3'

Posted On

2014-10-16