Incidental Mutation 'R2263:Fgf12'
ID243955
Institutional Source Beutler Lab
Gene Symbol Fgf12
Ensembl Gene ENSMUSG00000022523
Gene Namefibroblast growth factor 12
SynonymsFhf1
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location28160098-28753068 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 28189611 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 84 (K84*)
Ref Sequence ENSEMBL: ENSMUSP00000155924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100024] [ENSMUST00000231399] [ENSMUST00000232352]
Predicted Effect probably null
Transcript: ENSMUST00000100024
AA Change: K146*
SMART Domains Protein: ENSMUSP00000097601
Gene: ENSMUSG00000022523
AA Change: K146*

DomainStartEndE-ValueType
FGF 71 202 1.22e-62 SMART
Predicted Effect probably null
Transcript: ENSMUST00000231399
AA Change: K110*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231429
Predicted Effect probably null
Transcript: ENSMUST00000232352
AA Change: K84*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232632
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This growth factor lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, this protein accumulated in the nucleus, but was not secreted. The specific function of this gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and do not exhibit any significant behavioral or neurological phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Fgf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Fgf12 APN 16 28189599 missense possibly damaging 0.86
R0420:Fgf12 UTSW 16 28162529 missense possibly damaging 0.77
R0519:Fgf12 UTSW 16 28189628 missense probably benign 0.34
R0968:Fgf12 UTSW 16 28162433 missense probably null 0.00
R1216:Fgf12 UTSW 16 28162450 missense possibly damaging 0.51
R1686:Fgf12 UTSW 16 28398341 missense probably damaging 0.99
R5885:Fgf12 UTSW 16 28398294 missense possibly damaging 0.93
R7170:Fgf12 UTSW 16 28445179 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGAAGACCTGGTTCTAACACAC -3'
(R):5'- TGTACGTCGACTATAAATGGCTC -3'

Sequencing Primer
(F):5'- CCTGGTTCTAACACACAAATTAGGGG -3'
(R):5'- CTCTAACTGAAACTGTGTGCGGC -3'
Posted On2014-10-16