Mutagenetix > Incidental Mutation

Incidental Mutation 'R2263:Ticam1'

243959

Institutional Source

Beutler Lab

Gene Symbol

Ticam1

Ensembl Gene

ENSMUSG00000047123

Gene Name

toll-like receptor adaptor molecule 1

Synonyms

TICAM-1, Trif

MMRRC Submission

040263-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2263 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56269319-56276786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56271888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 69 (V69E)

Ref Sequence

ENSEMBL: ENSMUSP00000055104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058136]

AlphaFold

Q80UF7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058136
AA Change: V69E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: V69E

Domain	Start	End	E-Value	Type
PDB:4BSX\|D	5	153	3e-52	PDB
low complexity region	345	384	N/A	INTRINSIC
SCOP:d1fyva_	386	491	8e-3	SMART
PDB:2M1X\|A	391	547	1e-74	PDB
Pfam:RHIM	610	698	4.7e-13	PFAM

Meta Mutation Damage Score

0.1449

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	C	7: 29,532,562		noncoding transcript	Het
9130011E15Rik	A	G	19: 45,932,349		probably null	Het
Abca13	T	C	11: 9,274,702	S472P	probably benign	Het
Arsi	T	C	18: 60,916,665	Y207H	probably damaging	Het
Atp2b4	C	T	1: 133,726,533	R778Q	probably benign	Het
Bdp1	T	A	13: 100,066,037	D693V	probably damaging	Het
Car12	C	A	9: 66,747,631	Y114*	probably null	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col4a1	A	G	8: 11,312,586		probably benign	Het
Cryl1	G	T	14: 57,286,408	Y232*	probably null	Het
Dnah11	T	A	12: 117,880,025	M4362L	probably benign	Het
Dnah11	T	C	12: 117,966,639	T3324A	probably damaging	Het
Dnah8	A	G	17: 30,673,835	N798S	probably damaging	Het
Dok4	A	T	8: 94,866,512	C182S	probably damaging	Het
Ehbp1	A	T	11: 22,095,462	N737K	probably benign	Het
Eif2b4	T	C	5: 31,192,574		probably benign	Het
Fat4	T	C	3: 38,888,989	V677A	possibly damaging	Het
Fbn2	A	G	18: 58,095,176		probably benign	Het
Fbxl3	G	T	14: 103,083,212	Y314*	probably null	Het
Fgf12	T	A	16: 28,189,611	K84*	probably null	Het
Flt3	G	A	5: 147,348,063	P748L	probably benign	Het
Folh1	C	T	7: 86,719,765	S685N	probably benign	Het
Gm13119	A	G	4: 144,363,541	I384V	probably benign	Het
Gpr65	A	T	12: 98,275,235	N49I	probably damaging	Het
Hdac7	A	G	15: 97,810,851		probably null	Het
Heatr5a	A	T	12: 51,916,150	V989E	probably damaging	Het
Ikbkap	A	G	4: 56,755,298		probably null	Het
Kif12	A	G	4: 63,169,521	S242P	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Mia3	A	G	1: 183,334,793	Y295H	probably benign	Het
Nell1	C	T	7: 50,560,821	T494I	possibly damaging	Het
Nmur2	A	T	11: 56,029,561	V286E	probably damaging	Het
Olfr1378	G	A	11: 50,969,869	V284I	possibly damaging	Het
Olfr20	T	A	11: 73,354,305	L184Q	possibly damaging	Het
Olfr574	T	C	7: 102,949,257	F254S	probably damaging	Het
Pcdh1	A	T	18: 38,198,657	L431H	probably benign	Het
Prex1	A	T	2: 166,589,068		probably benign	Het
Prim1	T	A	10: 128,015,263	D5E	probably benign	Het
Rubcnl	A	T	14: 75,040,820	N348I	possibly damaging	Het
Shisa9	G	T	16: 11,984,767	A63S	possibly damaging	Het
Shpk	G	A	11: 73,206,493		probably benign	Het
Slx4ip	T	C	2: 137,044,015	I85T	probably damaging	Het
Sptbn4	T	A	7: 27,434,357	D77V	probably damaging	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Synrg	T	C	11: 83,977,152	M61T	possibly damaging	Het
Tekt4	T	A	17: 25,476,511	S439R	possibly damaging	Het
Trpv1	C	T	11: 73,241,682	A374V	probably damaging	Het
Ubqln3	A	T	7: 104,141,635	L416*	probably null	Het
Uqcrfs1	G	A	13: 30,541,107	S150L	probably benign	Het
Utp15	T	C	13: 98,257,925	N153S	probably benign	Het
Vmn2r63	G	T	7: 42,928,607	T169N	probably benign	Het
Vps13b	T	A	15: 35,646,181	V1477E	probably benign	Het
Xpo1	T	A	11: 23,284,634		probably null	Het
Xpo5	A	G	17: 46,230,343	I769V	probably benign	Het
Zc3h14	A	T	12: 98,758,514	H252L	probably benign	Het
Zfp410	G	T	12: 84,323,020		probably null	Het
Zfp521	T	C	18: 13,846,240	E372G	possibly damaging	Het

Other mutations in Ticam1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02160:Ticam1	APN	17	56270560	missense	possibly damaging	0.80
IGL02164:Ticam1	APN	17	56270019	missense	unknown
Lps2	UTSW	17	56269969	frame shift	probably null
Pangu	UTSW	17	56276693	critical splice donor site	probably benign
Yue	UTSW	17	56271339	missense	probably benign	0.06
R0930:Ticam1	UTSW	17	56270226	missense	unknown
R0930:Ticam1	UTSW	17	56271687	missense	probably damaging	1.00
R1509:Ticam1	UTSW	17	56271113	missense	probably benign	0.43
R1837:Ticam1	UTSW	17	56270799	missense	possibly damaging	0.87
R1863:Ticam1	UTSW	17	56271436	missense	probably damaging	1.00
R1867:Ticam1	UTSW	17	56271718	missense	probably benign	0.01
R1872:Ticam1	UTSW	17	56271897	missense	probably benign	0.00
R1893:Ticam1	UTSW	17	56271894	missense	probably benign	0.36
R1980:Ticam1	UTSW	17	56271555	missense	probably damaging	0.99
R1981:Ticam1	UTSW	17	56271555	missense	probably damaging	0.99
R1982:Ticam1	UTSW	17	56271555	missense	probably damaging	0.99
R2513:Ticam1	UTSW	17	56271612	missense	possibly damaging	0.61
R4294:Ticam1	UTSW	17	56271339	missense	probably benign	0.06
R4888:Ticam1	UTSW	17	56271642	missense	probably damaging	0.98
R4982:Ticam1	UTSW	17	56272020	missense	probably benign	0.10
R5396:Ticam1	UTSW	17	56271117	missense	probably benign	0.02
R5604:Ticam1	UTSW	17	56271756	missense	probably benign	0.13
R5641:Ticam1	UTSW	17	56270629	frame shift	probably null
R5647:Ticam1	UTSW	17	56270629	frame shift	probably null
R5648:Ticam1	UTSW	17	56270629	frame shift	probably null
R5657:Ticam1	UTSW	17	56270629	frame shift	probably null
R5770:Ticam1	UTSW	17	56270629	frame shift	probably null
R5771:Ticam1	UTSW	17	56270629	frame shift	probably null
R5964:Ticam1	UTSW	17	56271703	missense	probably damaging	0.99
R5974:Ticam1	UTSW	17	56271178	missense	probably benign
R6217:Ticam1	UTSW	17	56270730	missense	probably damaging	1.00
R6983:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R6984:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R6985:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R6986:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R6987:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R6988:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R6989:Ticam1	UTSW	17	56269900	missense	probably benign	0.00
R7029:Ticam1	UTSW	17	56271154	missense	possibly damaging	0.51
R7684:Ticam1	UTSW	17	56269984	missense	unknown
R7755:Ticam1	UTSW	17	56270182	missense	unknown
R7885:Ticam1	UTSW	17	56271067	missense	probably benign	0.04
R8021:Ticam1	UTSW	17	56270089	missense	unknown
R8414:Ticam1	UTSW	17	56271340	missense	probably benign	0.00
R8822:Ticam1	UTSW	17	56271444	missense	probably damaging	1.00
R9442:Ticam1	UTSW	17	56270428	missense	probably benign	0.00
R9521:Ticam1	UTSW	17	56271388	missense	probably benign	0.07
V8831:Ticam1	UTSW	17	56269969	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ATATCTGAACTGCACCGATCCC -3'
(R):5'- GCATTCTAGGTGCCTTGGAAAG -3'

Sequencing Primer
(F):5'- CTCATTCTGGAGTTGGCCCAG -3'
(R):5'- CCTTGGAAAGGGACAGGCTG -3'

Posted On

2014-10-16