Incidental Mutation 'R2263:9130011E15Rik'
ID243965
Institutional Source Beutler Lab
Gene Symbol 9130011E15Rik
Ensembl Gene ENSMUSG00000039901
Gene NameRIKEN cDNA 9130011E15 gene
Synonyms
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45818144-45998488 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 45932349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045396]
Predicted Effect probably null
Transcript: ENSMUST00000045396
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Meta Mutation Damage Score 0.9580 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in 9130011E15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:9130011E15Rik APN 19 45940488 missense probably benign 0.19
IGL00788:9130011E15Rik APN 19 45932350 critical splice donor site probably null
IGL01356:9130011E15Rik APN 19 45966303 missense possibly damaging 0.94
IGL01477:9130011E15Rik APN 19 45978604 missense probably damaging 0.99
IGL01660:9130011E15Rik APN 19 45940476 missense probably damaging 1.00
IGL02193:9130011E15Rik APN 19 45972884 missense probably benign 0.02
IGL02863:9130011E15Rik APN 19 45958411 missense probably damaging 1.00
IGL03108:9130011E15Rik APN 19 45820353 missense probably damaging 0.99
R0035:9130011E15Rik UTSW 19 45891240 missense probably damaging 1.00
R0791:9130011E15Rik UTSW 19 45933868 splice site probably null
R0792:9130011E15Rik UTSW 19 45933868 splice site probably null
R1487:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R1843:9130011E15Rik UTSW 19 45975252 missense probably benign 0.17
R2061:9130011E15Rik UTSW 19 45978667 missense probably damaging 1.00
R2070:9130011E15Rik UTSW 19 45891285 missense probably damaging 1.00
R2072:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2073:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2074:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2091:9130011E15Rik UTSW 19 45952680 missense probably damaging 1.00
R2863:9130011E15Rik UTSW 19 45885957 missense probably damaging 1.00
R3236:9130011E15Rik UTSW 19 45975283 splice site probably benign
R3796:9130011E15Rik UTSW 19 45921610 splice site probably benign
R4044:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R4716:9130011E15Rik UTSW 19 45960342 missense probably damaging 1.00
R4974:9130011E15Rik UTSW 19 45820287 missense probably damaging 1.00
R4983:9130011E15Rik UTSW 19 45950707 missense probably benign
R5063:9130011E15Rik UTSW 19 45885955 missense possibly damaging 0.95
R5313:9130011E15Rik UTSW 19 45818975 missense probably damaging 1.00
R5782:9130011E15Rik UTSW 19 45886027 missense probably benign 0.08
R5985:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R6220:9130011E15Rik UTSW 19 45846115 missense possibly damaging 0.79
R6379:9130011E15Rik UTSW 19 45921697 missense possibly damaging 0.46
R6674:9130011E15Rik UTSW 19 45974998 missense probably benign 0.06
R6842:9130011E15Rik UTSW 19 45818977 missense probably benign 0.05
R6890:9130011E15Rik UTSW 19 45960357 missense probably damaging 1.00
R7034:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7036:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7305:9130011E15Rik UTSW 19 45892121 missense probably benign 0.35
R7411:9130011E15Rik UTSW 19 45965435 missense probably benign 0.00
R7762:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R8021:9130011E15Rik UTSW 19 45956741 critical splice acceptor site probably null
R8366:9130011E15Rik UTSW 19 45932354 missense probably damaging 1.00
X0060:9130011E15Rik UTSW 19 45932393 missense possibly damaging 0.95
Z1088:9130011E15Rik UTSW 19 45818905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCAAACTGTAGCTTGTACTTTC -3'
(R):5'- TCATGCAGATAGATGTCCGC -3'

Sequencing Primer
(F):5'- TACAGGCTATTGTGAACCGC -3'
(R):5'- GCAGGGCTGTACTCAGTGAG -3'
Posted On2014-10-16