Incidental Mutation 'R2264:Gpr89'
ID243982
Institutional Source Beutler Lab
Gene Symbol Gpr89
Ensembl Gene ENSMUSG00000028096
Gene NameG protein-coupled receptor 89
Synonyms4933412D19Rik, SH120
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96868281-96905346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96872515 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 375 (S375P)
Ref Sequence ENSEMBL: ENSMUSP00000029738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029738] [ENSMUST00000058865] [ENSMUST00000107069] [ENSMUST00000107070] [ENSMUST00000153256]
Predicted Effect probably damaging
Transcript: ENSMUST00000029738
AA Change: S375P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029738
Gene: ENSMUSG00000028096
AA Change: S375P

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
Pfam:GPHR_N 140 207 1.1e-31 PFAM
Pfam:ABA_GPCR 276 446 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058865
SMART Domains Protein: ENSMUSP00000058936
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107069
SMART Domains Protein: ENSMUSP00000102684
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107070
SMART Domains Protein: ENSMUSP00000102685
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146645
Predicted Effect probably benign
Transcript: ENSMUST00000153256
SMART Domains Protein: ENSMUSP00000118846
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Meta Mutation Damage Score 0.6322 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,274 S1042P probably damaging Het
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cldn1 A G 16: 26,359,199 Y159H probably damaging Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Parp6 T C 9: 59,624,005 S57P probably damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pea15a C T 1: 172,199,137 R79H probably benign Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slc14a2 T C 18: 78,163,089 probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Gpr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gpr89 APN 3 96898523 missense probably damaging 1.00
IGL00757:Gpr89 APN 3 96871534 missense probably benign 0.00
IGL01114:Gpr89 APN 3 96893549 missense probably damaging 0.98
IGL02417:Gpr89 APN 3 96897425 nonsense probably null
explorer UTSW 3 96880069 splice site probably null
R0207:Gpr89 UTSW 3 96871480 missense probably damaging 0.99
R0650:Gpr89 UTSW 3 96897324 splice site probably benign
R0704:Gpr89 UTSW 3 96880168 critical splice acceptor site probably null
R1496:Gpr89 UTSW 3 96905210 missense probably benign 0.00
R1869:Gpr89 UTSW 3 96875659 missense probably benign 0.16
R1913:Gpr89 UTSW 3 96875633 missense possibly damaging 0.91
R2276:Gpr89 UTSW 3 96897427 missense probably damaging 1.00
R3822:Gpr89 UTSW 3 96892944 missense probably benign 0.03
R3922:Gpr89 UTSW 3 96890899 missense probably damaging 1.00
R4984:Gpr89 UTSW 3 96905196 missense probably benign 0.02
R5761:Gpr89 UTSW 3 96892880 missense probably damaging 1.00
R6185:Gpr89 UTSW 3 96890833 missense probably damaging 0.99
R7063:Gpr89 UTSW 3 96875698 missense probably damaging 1.00
R7164:Gpr89 UTSW 3 96871398 missense probably benign 0.04
R7172:Gpr89 UTSW 3 96880069 splice site probably null
R7215:Gpr89 UTSW 3 96880088 missense probably damaging 1.00
R7536:Gpr89 UTSW 3 96890893 missense probably damaging 0.96
R7708:Gpr89 UTSW 3 96880625 missense possibly damaging 0.81
R7849:Gpr89 UTSW 3 96871490 nonsense probably null
R7932:Gpr89 UTSW 3 96871490 nonsense probably null
RF019:Gpr89 UTSW 3 96905193 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGGGCCCAACTTAAACCAT -3'
(R):5'- TGTGTTGTATTTGAAGGCCCTC -3'

Sequencing Primer
(F):5'- GCTTGAAGTCTCAGCACTTCAGAG -3'
(R):5'- ATTTGAAGGCCCTCTCTGTAG -3'
Posted On2014-10-16