Incidental Mutation 'R2264:Loxl1'
ID244000
Institutional Source Beutler Lab
Gene Symbol Loxl1
Ensembl Gene ENSMUSG00000032334
Gene Namelysyl oxidase-like 1
SynonymsLOXL
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58287738-58313186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58297678 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 418 (V418A)
Ref Sequence ENSEMBL: ENSMUSP00000057406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061799]
Predicted Effect probably damaging
Transcript: ENSMUST00000061799
AA Change: V418A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057406
Gene: ENSMUSG00000032334
AA Change: V418A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 82 96 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
Pfam:Lysyl_oxidase 403 604 5.1e-98 PFAM
Meta Mutation Damage Score 0.6809 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: This gene encodes a member of the lysyl oxidase family of copper-dependent enzymes that catalyze the formation of lysine-derived crosslinks in proteins such as collagen and elastin. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional enzyme. Mice lacking the encoded protein fail to deposit normal elastic fibers in the uterine tract post partum and develop pelvic organ prolapse, enlarged airspaces of the lung, loose skin and vascular abnormalities with concomitant tropoelastin accumulation. [provided by RefSeq, Sep 2016]
PHENOTYPE: Elastic fiber homeostasis is disrupted in homozygous mutant mice, resulting in loose skin, abnormal lung morphology, intestinal defects, and post partum uterine prolapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,274 S1042P probably damaging Het
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cldn1 A G 16: 26,359,199 Y159H probably damaging Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gpr89 A G 3: 96,872,515 S375P probably damaging Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Parp6 T C 9: 59,624,005 S57P probably damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pea15a C T 1: 172,199,137 R79H probably benign Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slc14a2 T C 18: 78,163,089 probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Loxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Loxl1 APN 9 58294422 missense possibly damaging 0.89
IGL02549:Loxl1 APN 9 58293638 missense probably damaging 1.00
IGL02562:Loxl1 APN 9 58288916 missense probably damaging 1.00
IGL03062:Loxl1 APN 9 58311910 missense possibly damaging 0.61
R0141:Loxl1 UTSW 9 58312132 missense probably damaging 0.98
R1503:Loxl1 UTSW 9 58293640 missense probably damaging 1.00
R1898:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R2125:Loxl1 UTSW 9 58293712 missense probably damaging 1.00
R4094:Loxl1 UTSW 9 58312456 missense probably damaging 0.98
R4993:Loxl1 UTSW 9 58312537 missense probably damaging 0.99
R5484:Loxl1 UTSW 9 58290782 missense possibly damaging 0.75
R5598:Loxl1 UTSW 9 58312367 missense possibly damaging 0.71
R5808:Loxl1 UTSW 9 58294449 missense probably damaging 0.99
R5917:Loxl1 UTSW 9 58312723 missense probably damaging 1.00
R7566:Loxl1 UTSW 9 58312198 missense probably damaging 0.98
R7899:Loxl1 UTSW 9 58290834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTGTAGCAAAGGGCC -3'
(R):5'- ACTAACCTCCTTGAGCCCAG -3'

Sequencing Primer
(F):5'- ACTCCTTGAGCCAGGCAAGATG -3'
(R):5'- AGGACCCTCTGACCAGGAAG -3'
Posted On2014-10-16