Incidental Mutation 'R2264:Parp6'
ID244002
Institutional Source Beutler Lab
Gene Symbol Parp6
Ensembl Gene ENSMUSG00000025237
Gene Namepoly (ADP-ribose) polymerase family, member 6
Synonyms
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59617284-59650285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59624005 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000063065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026267] [ENSMUST00000050483] [ENSMUST00000167091] [ENSMUST00000216351]
Predicted Effect probably benign
Transcript: ENSMUST00000026267
AA Change: S57P

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026267
Gene: ENSMUSG00000025237
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Pfam:PARP 450 580 5.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050483
AA Change: S57P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063065
Gene: ENSMUSG00000025237
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 303 315 N/A INTRINSIC
SCOP:d1a26_2 409 475 4e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167091
AA Change: S57P

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129456
Gene: ENSMUSG00000025237
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
SCOP:d1a26_2 429 473 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215381
Predicted Effect possibly damaging
Transcript: ENSMUST00000216351
AA Change: S57P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217195
Meta Mutation Damage Score 0.2796 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,274 S1042P probably damaging Het
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cldn1 A G 16: 26,359,199 Y159H probably damaging Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gpr89 A G 3: 96,872,515 S375P probably damaging Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pea15a C T 1: 172,199,137 R79H probably benign Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slc14a2 T C 18: 78,163,089 probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Parp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Parp6 APN 9 59632959 missense probably damaging 1.00
IGL01366:Parp6 APN 9 59636713 missense possibly damaging 0.75
IGL01385:Parp6 APN 9 59630612 splice site probably benign
IGL02000:Parp6 APN 9 59648892 missense probably benign 0.00
IGL02001:Parp6 APN 9 59649961 missense possibly damaging 0.90
IGL02315:Parp6 APN 9 59641738 intron probably benign
IGL02719:Parp6 APN 9 59630738 missense probably benign 0.26
IGL02928:Parp6 APN 9 59641063 missense possibly damaging 0.70
IGL03169:Parp6 APN 9 59650017 nonsense probably null
IGL03398:Parp6 APN 9 59641053 missense probably damaging 0.97
R0165:Parp6 UTSW 9 59632925 missense probably damaging 1.00
R0602:Parp6 UTSW 9 59649365 splice site probably benign
R0781:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1110:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1730:Parp6 UTSW 9 59633538 nonsense probably null
R1783:Parp6 UTSW 9 59633538 nonsense probably null
R4323:Parp6 UTSW 9 59630686 missense possibly damaging 0.84
R4654:Parp6 UTSW 9 59641100 splice site probably null
R4672:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4673:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4708:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4709:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4763:Parp6 UTSW 9 59631365 missense probably damaging 1.00
R4782:Parp6 UTSW 9 59634984 splice site probably null
R4825:Parp6 UTSW 9 59624362 splice site probably null
R5563:Parp6 UTSW 9 59628673 splice site probably null
R5700:Parp6 UTSW 9 59624727 missense probably damaging 1.00
R6235:Parp6 UTSW 9 59630815 missense probably benign 0.34
R6269:Parp6 UTSW 9 59650012 missense probably benign
R6383:Parp6 UTSW 9 59623939 missense probably damaging 0.99
X0061:Parp6 UTSW 9 59630765 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACCAAGAACCTGTGTGCTGC -3'
(R):5'- CAGCCCTTCTTACCTCAAAGG -3'

Sequencing Primer
(F):5'- GTGTGCTGCACTTTATGTCTC -3'
(R):5'- CCTCAAAGGTGAAACTAATGACG -3'
Posted On2014-10-16