Mutagenetix > Incidental Mutation

Incidental Mutation 'R0277:Tbx15'

24401

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

038499-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R0277 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 99352391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 526 (P526L)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: P526L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: P526L

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.4897

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 95.0%
20x: 89.3%

Validation Efficiency

99% (111/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930533L02Rik	A	G	7: 125,318,643	K69R	unknown	Het
4932438A13Rik	T	A	3: 36,943,182	C1129*	probably null	Het
Abca13	A	C	11: 9,294,701	D2188A	probably benign	Het
Acad11	T	C	9: 104,124,025	M708T	probably damaging	Het
Adam7	T	C	14: 68,510,857		probably null	Het
Adgre1	T	A	17: 57,444,060	I578N	probably benign	Het
Agbl4	T	C	4: 111,617,222	S403P	probably damaging	Het
Ak3	A	G	19: 29,047,792	M13T	possibly damaging	Het
Ap2s1	T	C	7: 16,747,380		probably benign	Het
Arhgef1	A	T	7: 24,923,799		probably benign	Het
Arsk	T	C	13: 76,074,932	N182S	probably benign	Het
Aspscr1	G	A	11: 120,678,420	V15I	probably damaging	Het
Asxl2	A	G	12: 3,442,487	Y24C	probably damaging	Het
Atp8b1	A	G	18: 64,568,252	F345S	possibly damaging	Het
Atp8b3	T	C	10: 80,526,909	K672E	probably benign	Het
Bmp2k	A	G	5: 97,087,823		probably benign	Het
Casp6	T	A	3: 129,910,523	V86E	probably benign	Het
Cdca5	A	G	19: 6,090,712	E260G	unknown	Het
Cpb2	T	A	14: 75,265,458	V159D	probably damaging	Het
Cylc2	T	A	4: 51,228,477	S183T	unknown	Het
Dhtkd1	T	A	2: 5,914,888	M561L	probably benign	Het
Dync2h1	T	C	9: 7,129,046	D1823G	probably benign	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
Erc1	T	C	6: 119,620,328	K1003E	probably damaging	Het
Ezr	G	A	17: 6,754,765	Q105*	probably null	Het
Fam83d	T	A	2: 158,785,547	D385E	probably benign	Het
Fbn2	A	G	18: 58,045,317	C1950R	probably damaging	Het
Fbxo32	A	T	15: 58,184,209	I236N	probably damaging	Het
Fcgbp	G	T	7: 28,085,493		probably null	Het
Foxe3	T	C	4: 114,925,608	N136D	probably damaging	Het
Fscn2	A	T	11: 120,368,011	I461F	probably damaging	Het
Gldc	A	G	19: 30,116,451	I722T	possibly damaging	Het
Gm10717	T	G	9: 3,025,619	V68G	possibly damaging	Het
Gm4841	A	G	18: 60,270,646	L125S	possibly damaging	Het
Gnl3	A	C	14: 31,013,427		probably null	Het
Gsto1	A	T	19: 47,857,977	I88F	probably damaging	Het
Gucy1b1	T	A	3: 82,038,156		probably null	Het
Hhla1	C	A	15: 65,948,503	V133F	probably benign	Het
Hipk3	T	A	2: 104,441,248	L446F	probably damaging	Het
Hscb	T	C	5: 110,834,690	E177G	possibly damaging	Het
Hsd17b6	T	C	10: 127,991,405	D266G	probably benign	Het
Ipo4	T	C	14: 55,632,115	S363G	probably benign	Het
Kcnip3	A	G	2: 127,459,979		probably benign	Het
Klhl41	A	G	2: 69,671,296	Y367C	probably damaging	Het
Klk1b4	C	G	7: 44,211,629	P232R	possibly damaging	Het
Lcp2	A	G	11: 34,054,322	D53G	probably damaging	Het
Llgl2	A	G	11: 115,850,720	K559E	probably damaging	Het
Lrrc59	A	C	11: 94,643,422	T269P	probably damaging	Het
Mark1	A	G	1: 184,944,952	S34P	possibly damaging	Het
Megf11	G	A	9: 64,691,350		probably null	Het
Mplkip	A	G	13: 17,696,980	I159V	possibly damaging	Het
Muc4	C	A	16: 32,755,690		probably benign	Het
Myo18b	A	G	5: 112,693,347		probably benign	Het
Myo9b	T	C	8: 71,355,952		probably benign	Het
Napg	C	T	18: 62,986,963	R149C	probably damaging	Het
Ndrg3	A	G	2: 156,934,935		probably benign	Het
Nfe2l3	T	A	6: 51,457,468	M336K	probably benign	Het
Nrxn1	A	C	17: 90,700,742		probably null	Het
Nsun3	A	T	16: 62,776,644		probably benign	Het
Nuak1	T	C	10: 84,374,451	E591G	probably benign	Het
Olfr1347	T	A	7: 6,488,434	M147L	probably benign	Het
Olfr1511	T	C	14: 52,390,389	Y128C	probably damaging	Het
Olfr215	A	T	6: 116,582,601	V115E	probably damaging	Het
Olfr23	A	T	11: 73,940,947	I234F	probably benign	Het
Olfr730	T	C	14: 50,186,332	N296S	probably null	Het
Olfr814	T	A	10: 129,874,067	Q230L	probably damaging	Het
Olfr982	G	A	9: 40,074,714	V140I	probably benign	Het
Orc4	A	T	2: 48,937,467	V38E	possibly damaging	Het
Ovgp1	T	C	3: 105,979,892		probably benign	Het
Palm3	T	A	8: 84,028,720	V287D	probably damaging	Het
Pde4dip	T	A	3: 97,843,712	H62L	probably benign	Het
Pdk4	G	T	6: 5,491,620	P100Q	probably damaging	Het
Pdss2	T	A	10: 43,372,176	H225Q	probably benign	Het
Pkhd1	A	T	1: 20,275,538	D2755E	probably benign	Het
Prune2	A	T	19: 17,121,389	D1419V	probably damaging	Het
Pth2r	A	C	1: 65,388,616	I483L	probably benign	Het
Qrsl1	A	G	10: 43,896,007		probably null	Het
Rab11fip4	A	G	11: 79,686,629	H403R	possibly damaging	Het
Ralgapa1	A	T	12: 55,677,238	I1548N	probably damaging	Het
Ric8a	T	G	7: 140,857,900		probably benign	Het
Rsbn1	T	C	3: 103,914,581	F44S	possibly damaging	Het
Serpinc1	T	A	1: 160,989,702	M1K	probably null	Het
Sf3b1	T	C	1: 55,019,257	I58V	probably damaging	Het
Sh3d19	T	A	3: 86,126,671	M777K	probably benign	Het
Sipa1	A	T	19: 5,654,065	M743K	probably benign	Het
Skint5	T	C	4: 113,937,621	H255R	probably benign	Het
Slco6b1	A	T	1: 96,988,673		noncoding transcript	Het
Slfn4	A	T	11: 83,186,951	R188S	probably damaging	Het
Sort1	T	C	3: 108,324,592		probably benign	Het
Spg21	A	T	9: 65,465,347	K20N	possibly damaging	Het
Sptbn2	A	T	19: 4,745,145	I1544F	probably benign	Het
Srf	T	C	17: 46,549,489	T456A	possibly damaging	Het
Ssbp2	T	A	13: 91,564,596		probably benign	Het
Stx2	C	T	5: 128,988,903	V230I	probably benign	Het
Sv2b	A	T	7: 75,206,439	D34E	possibly damaging	Het
Synpo2l	A	G	14: 20,661,788	S255P	probably damaging	Het
Tenm4	C	A	7: 96,694,950	P250Q	possibly damaging	Het
Tgm1	C	A	14: 55,710,927		probably benign	Het
Tgm1	T	C	14: 55,712,652		probably benign	Het
Thsd7b	A	G	1: 130,195,263	I1540V	probably benign	Het
Tnrc6c	A	G	11: 117,739,881	K1023E	probably damaging	Het
Ube2l6	A	T	2: 84,806,427		probably null	Het
Uty	T	A	Y: 1,169,979	I326F	probably damaging	Het
Wdfy4	T	C	14: 33,083,785	D1735G	possibly damaging	Het
Wnt11	A	G	7: 98,847,383	K177E	probably damaging	Het
Wnt5a	A	T	14: 28,513,268	M70L	possibly damaging	Het
Wwc1	T	A	11: 35,852,348	E882V	probably damaging	Het
Zfp455	G	T	13: 67,198,664		probably null	Het
Zmpste24	A	G	4: 121,082,853	Y199H	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTATCCACCATGTGCCCGAAG -3'
(R):5'- TACTGTCGGCCATCACAGGTGTTG -3'

Sequencing Primer
(F):5'- TGCCTTACAGAGCTATCCAGG -3'
(R):5'- CCATCACAGGTGTTGGTAGC -3'

Posted On

2013-04-16