Incidental Mutation 'R2264:Cldn1'
ID244023
Institutional Source Beutler Lab
Gene Symbol Cldn1
Ensembl Gene ENSMUSG00000022512
Gene Nameclaudin 1
Synonyms
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location26356642-26371841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26359199 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 159 (Y159H)
Ref Sequence ENSEMBL: ENSMUSP00000023154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023154]
Predicted Effect probably damaging
Transcript: ENSMUST00000023154
AA Change: Y159H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023154
Gene: ENSMUSG00000022512
AA Change: Y159H

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2e-54 PFAM
Pfam:Claudin_2 15 184 4.4e-10 PFAM
low complexity region 187 205 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232215
Meta Mutation Damage Score 0.7558 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The knockout mice lacking this gene die soon after birth as a consequence of dehydration from trandermal water loss, indicating that this gene is indispensable for creating and maintaining the epidermal barrier. The protein encoded by this gene also has gastric tumor suppressive activity, and is a key factor for hepatitis C virus (HCV) entry. [provided by RefSeq, Aug 2010]
PHENOTYPE: Animals homozygous for a mutation in this gene have wrinkled skin and die within 1 day after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,274 S1042P probably damaging Het
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gpr89 A G 3: 96,872,515 S375P probably damaging Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Parp6 T C 9: 59,624,005 S57P probably damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pea15a C T 1: 172,199,137 R79H probably benign Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slc14a2 T C 18: 78,163,089 probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Cldn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Cldn1 APN 16 26371572 missense possibly damaging 0.59
IGL02937:Cldn1 APN 16 26360873 missense probably damaging 1.00
R1626:Cldn1 UTSW 16 26371452 missense probably damaging 1.00
R2131:Cldn1 UTSW 16 26371550 missense probably damaging 0.98
R3778:Cldn1 UTSW 16 26371466 missense probably damaging 1.00
R4850:Cldn1 UTSW 16 26363163 missense probably benign 0.04
R5711:Cldn1 UTSW 16 26371417 missense probably damaging 1.00
R5753:Cldn1 UTSW 16 26363121 missense probably benign 0.01
R6017:Cldn1 UTSW 16 26363219 missense probably damaging 1.00
R7134:Cldn1 UTSW 16 26371626 start codon destroyed probably null 0.98
R7199:Cldn1 UTSW 16 26371596 missense probably benign 0.06
R7373:Cldn1 UTSW 16 26360856 missense probably damaging 1.00
R7600:Cldn1 UTSW 16 26360919 missense probably benign
R7675:Cldn1 UTSW 16 26371511 missense probably benign 0.00
Z1177:Cldn1 UTSW 16 26360864 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTATTTGCTCCAGGAAGATCTC -3'
(R):5'- GCCTCCTTTGCTTGGAAAGG -3'

Sequencing Primer
(F):5'- GAAGATCTCTTCCTTTGCCTCTG -3'
(R):5'- ATTGCATGTCCTATTACCAATGTGC -3'
Posted On2014-10-16