Incidental Mutation 'R2265:Aox1'
ID244037
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 040265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2265 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58081520 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 857 (D857E)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably damaging
Transcript: ENSMUST00000001027
AA Change: D857E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: D857E

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Ddx4 A G 13: 112,621,276 Y290H probably benign Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr164 A G 16: 19,286,555 Y63H probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Zfp616 T C 11: 74,085,463 Y853H possibly damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATTGATTATCTCTCTAAGGAGCACC -3'
(R):5'- CAAGATCTCTGAGCTCCGTC -3'

Sequencing Primer
(F):5'- ATCAAGATAATCTCTCCCTGGGG -3'
(R):5'- ACCCGTGGTTTTCAGGAAATC -3'
Posted On2014-10-16