Mutagenetix > Incidental Mutations

Incidental Mutation 'R2265:Rtel1'

244050

Institutional Source

Beutler Lab

Gene Symbol

Rtel1

Ensembl Gene

ENSMUSG00000038685

Gene Name

regulator of telomere elongation helicase 1

Synonyms

Nhl, Rtel, KIAA1088, C20ORF41

MMRRC Submission

040265-MU

Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2265 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

181319739-181356616 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 181354368 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 739 (V739D)

Ref Sequence

ENSEMBL: ENSMUSP00000116159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108808] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000127988] [ENSMUST00000148252] [ENSMUST00000170190] [ENSMUST00000185118]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048608
AA Change: V956D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: V956D

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000054622
AA Change: V956D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: V956D

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1075	1092	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098971
AA Change: V956D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: V956D

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1036	1053	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108808

SMART Domains

Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
ARF	1	191	1.71e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108814
AA Change: V956D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: V956D

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1069	1086	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108815
AA Change: V956D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: V956D

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1030	1047	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125233

Predicted Effect

probably benign
Transcript: ENSMUST00000127988

SMART Domains

Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
ARF	1	191	1.71e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130935

Predicted Effect

probably benign
Transcript: ENSMUST00000133856

Predicted Effect

probably benign
Transcript: ENSMUST00000134651

Predicted Effect

probably benign
Transcript: ENSMUST00000137700

Predicted Effect

probably damaging
Transcript: ENSMUST00000148252
AA Change: V739D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: V739D

Domain	Start	End	E-Value	Type
Pfam:DEAD_2	1	88	1.3e-33	PFAM
HELICc	379	533	1.07e-62	SMART
low complexity region	858	875	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147266

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144648

Predicted Effect

probably benign
Transcript: ENSMUST00000170190

SMART Domains

Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
Pfam:Miro	1	90	1.2e-9	PFAM
Pfam:Arf	1	140	8.5e-38	PFAM
Pfam:Gtr1_RagA	2	110	2.2e-6	PFAM
Pfam:SRPRB	4	118	6e-8	PFAM
Pfam:Ras	4	142	2.7e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000185118

SMART Domains

Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
Pfam:Arf	4	120	1.6e-30	PFAM
Pfam:SRPRB	15	116	6.6e-8	PFAM
Pfam:Ras	19	116	2.1e-9	PFAM
Pfam:Miro	19	117	7.3e-12	PFAM
Pfam:MMR_HSR1	19	117	1.2e-7	PFAM
Pfam:Gtr1_RagA	19	119	5.5e-9	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578C19Rik	A	G	X: 18,423,687	S179P	possibly damaging	Het
A830018L16Rik	T	C	1: 11,972,104		probably null	Het
Aadac	T	A	3: 60,037,316	D136E	probably damaging	Het
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Adam24	T	A	8: 40,680,071	S193T	possibly damaging	Het
Adra2b	T	C	2: 127,363,871	S103P	probably damaging	Het
Agrn	C	T	4: 156,179,218	G173R	probably damaging	Het
Alg11	T	A	8: 22,065,614	V255E	probably benign	Het
Aox1	C	A	1: 58,081,520	D857E	probably damaging	Het
Apob	T	C	12: 8,015,475	F4115S	possibly damaging	Het
Bdkrb2	A	G	12: 105,592,225	T242A	probably benign	Het
Cdca7	T	C	2: 72,482,490	L190P	probably benign	Het
Cenpe	A	G	3: 135,261,636	T2180A	probably benign	Het
Cep41	T	A	6: 30,660,916	I126F	possibly damaging	Het
Col16a1	C	A	4: 130,052,918	H111Q	probably benign	Het
Cops3	T	C	11: 59,827,890	T193A	probably benign	Het
Dbr1	G	A	9: 99,579,410	V153M	probably damaging	Het
Ddx4	A	G	13: 112,621,276	Y290H	probably benign	Het
Dgkb	T	A	12: 38,190,108	S461R	possibly damaging	Het
Dnajc28	T	C	16: 91,616,312	N372S	probably benign	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock3	C	A	9: 106,941,326	V1190F	probably damaging	Het
Exosc1	A	G	19: 41,931,418	S54P	probably damaging	Het
Fbxw22	C	T	9: 109,383,994	R295K	probably benign	Het
Foxo1	T	C	3: 52,345,912	S499P	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hspa2	T	G	12: 76,406,188	I552S	probably benign	Het
Imp4	T	A	1: 34,443,847	I173N	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Kcnh6	G	A	11: 106,033,817	R816Q	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Kcnip3	G	T	2: 127,465,061	A173D	probably benign	Het
Kir3dl1	A	G	X: 136,525,035	R53G	probably benign	Het
Klhl31	A	G	9: 77,650,158	D52G	possibly damaging	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lilrb4a	T	A	10: 51,491,537	Y58*	probably null	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mpdz	A	G	4: 81,383,391	S266P	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mroh7	T	C	4: 106,720,927	N185D	probably benign	Het
Mybphl	A	G	3: 108,365,001	E2G	probably damaging	Het
Mycbp2	T	C	14: 103,262,749	D937G	probably benign	Het
Myo18b	A	G	5: 112,782,673	M1799T	probably damaging	Het
Nr4a2	T	A	2: 57,112,006	D145V	possibly damaging	Het
Ntmt1	C	A	2: 30,820,460	N58K	probably benign	Het
Olfr1066	T	C	2: 86,456,214	Y19C	possibly damaging	Het
Olfr1278	A	G	2: 111,293,179	T304A	probably benign	Het
Olfr1330	A	T	4: 118,893,874	R264W	probably damaging	Het
Olfr164	A	G	16: 19,286,555	Y63H	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Olfr659	T	C	7: 104,670,860	F53L	probably benign	Het
Ovch2	A	T	7: 107,784,575	M521K	probably damaging	Het
P2ry13	T	C	3: 59,210,028	M110V	probably damaging	Het
P2ry14	T	C	3: 59,115,571	N165S	probably damaging	Het
Pcdhb19	A	T	18: 37,497,683	H177L	probably damaging	Het
Phf8	T	C	X: 151,572,601	L520S	possibly damaging	Het
Pjvk	T	G	2: 76,657,453	S230A	possibly damaging	Het
Plch2	T	C	4: 154,993,004	E423G	probably benign	Het
Rad9b	T	C	5: 122,351,342	Y41C	probably damaging	Het
Ranbp3l	A	T	15: 9,057,113	I286F	probably damaging	Het
Slc35a3	T	C	3: 116,673,636	K325E	possibly damaging	Het
Spag17	C	A	3: 100,061,866		probably null	Het
Spg11	A	T	2: 122,108,307	C389S	possibly damaging	Het
Srsf4	T	C	4: 131,897,682	V130A	probably damaging	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Tas2r117	T	A	6: 132,803,225	C109S	probably benign	Het
Tlr5	T	A	1: 182,975,035	S635T	possibly damaging	Het
Ttc21a	G	T	9: 119,959,008	C833F	possibly damaging	Het
Vash2	T	C	1: 190,950,213	N347D	probably damaging	Het
Vcp	G	A	4: 42,980,833	A759V	possibly damaging	Het
Vmn2r18	T	C	5: 151,586,662	E82G	probably damaging	Het
Vps13c	T	C	9: 67,920,947	V1461A	possibly damaging	Het
Zfp616	T	C	11: 74,085,463	Y853H	possibly damaging	Het

Other mutations in Rtel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Rtel1	APN	2	181354401	missense	probably benign	0.16
IGL01957:Rtel1	APN	2	181349313	unclassified	probably benign
IGL02247:Rtel1	APN	2	181351341	nonsense	probably null
IGL02414:Rtel1	APN	2	181335972	missense	probably benign	0.01
IGL02448:Rtel1	APN	2	181336037	missense	probably benign	0.00
IGL03053:Rtel1	APN	2	181351944	missense	probably benign	0.02
IGL03059:Rtel1	APN	2	181350183	missense	probably benign	0.01
IGL03326:Rtel1	APN	2	181355561	unclassified	probably benign
PIT4283001:Rtel1	UTSW	2	181346890	missense	probably benign	0.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0147:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0148:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0316:Rtel1	UTSW	2	181356002	missense	possibly damaging	0.87
R0628:Rtel1	UTSW	2	181351881	missense	probably benign	0.03
R0940:Rtel1	UTSW	2	181322803	missense	probably benign	0.36
R1165:Rtel1	UTSW	2	181334939	missense	probably benign	0.26
R1213:Rtel1	UTSW	2	181351335	missense	probably benign	0.01
R1291:Rtel1	UTSW	2	181351043	missense	probably damaging	1.00
R1353:Rtel1	UTSW	2	181349231	missense	probably benign
R1398:Rtel1	UTSW	2	181335865	splice site	probably null
R1796:Rtel1	UTSW	2	181352103	missense	probably benign	0.01
R1973:Rtel1	UTSW	2	181351626	missense	probably benign	0.04
R2033:Rtel1	UTSW	2	181351863	nonsense	probably null
R2144:Rtel1	UTSW	2	181323706	missense	probably damaging	0.97
R2269:Rtel1	UTSW	2	181336003	missense	probably benign	0.00
R2416:Rtel1	UTSW	2	181340531	missense	possibly damaging	0.66
R2865:Rtel1	UTSW	2	181349972	missense	probably benign	0.36
R3508:Rtel1	UTSW	2	181322409	missense	probably benign	0.32
R4242:Rtel1	UTSW	2	181349934	missense	probably damaging	1.00
R4377:Rtel1	UTSW	2	181355796	missense	probably damaging	1.00
R4702:Rtel1	UTSW	2	181352169	missense	probably benign	0.30
R4706:Rtel1	UTSW	2	181323746	critical splice donor site	probably null
R4817:Rtel1	UTSW	2	181355935	missense	possibly damaging	0.82
R5020:Rtel1	UTSW	2	181322514	splice site	probably null
R5069:Rtel1	UTSW	2	181355492	missense	probably benign	0.03
R5222:Rtel1	UTSW	2	181346983	intron	probably benign
R5268:Rtel1	UTSW	2	181340561	missense	probably benign	0.03
R5291:Rtel1	UTSW	2	181352095	missense	possibly damaging	0.47
R5588:Rtel1	UTSW	2	181352100	missense	probably benign
R5682:Rtel1	UTSW	2	181349972	missense	probably benign	0.19
R5796:Rtel1	UTSW	2	181340506	missense	probably benign	0.26
R5931:Rtel1	UTSW	2	181330815	nonsense	probably null
R6249:Rtel1	UTSW	2	181351682	missense	probably damaging	1.00
R6465:Rtel1	UTSW	2	181335940	missense	possibly damaging	0.68
R6616:Rtel1	UTSW	2	181352786	missense	possibly damaging	0.68
R6800:Rtel1	UTSW	2	181322463	missense	probably benign	0.31
R6835:Rtel1	UTSW	2	181355953	missense	probably benign	0.04
R6917:Rtel1	UTSW	2	181338277	makesense	probably null
R7264:Rtel1	UTSW	2	181351861	missense	not run
R7381:Rtel1	UTSW	2	181330815	nonsense	probably null
R7523:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7587:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7681:Rtel1	UTSW	2	181322394	missense	probably damaging	0.99
R7871:Rtel1	UTSW	2	181321029	missense	probably damaging	1.00
R7912:Rtel1	UTSW	2	181356076	missense	possibly damaging	0.56
R8007:Rtel1	UTSW	2	181334974	missense	probably damaging	1.00
R8062:Rtel1	UTSW	2	181340567	missense	probably benign	0.17
R8088:Rtel1	UTSW	2	181322345	missense	probably damaging	1.00
R8435:Rtel1	UTSW	2	181354104	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AAACACACCCTGCTTAAAGGTG -3'
(R):5'- CCATTTCCAGTGTAAACTGCCC -3'

Sequencing Primer
(F):5'- AGGTGCCCTGGTTTTCAAAATTC -3'
(R):5'- GTAAACTGCCCTTCAAGTCTGAGG -3'

Posted On

2014-10-16