Incidental Mutation 'R2265:Plch2'
ID 244066
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Name phospholipase C, eta 2
Synonyms Plcl4, A930027K05Rik, PLCeta2
MMRRC Submission 040265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2265 (G1)
Quality Score 222
Status Not validated
Chromosome 4
Chromosomal Location 154983115-155056784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154993004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 423 (E423G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]
AlphaFold A2AP18
Predicted Effect probably benign
Transcript: ENSMUST00000105631
AA Change: E639G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: E639G

low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124517
SMART Domains Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

C2 1 77 1.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect probably benign
Transcript: ENSMUST00000135665
AA Change: E534G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: E534G

PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139976
AA Change: E639G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: E639G

low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175982
AA Change: E423G

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000176194
AA Change: E538G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: E538G

PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176620
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Aox1 C A 1: 58,081,520 D857E probably damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Ddx4 A G 13: 112,621,276 Y290H probably benign Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr164 A G 16: 19,286,555 Y63H probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Zfp616 T C 11: 74,085,463 Y853H possibly damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 splice site probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 splice site probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
R7844:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R7939:Plch2 UTSW 4 155002778 missense possibly damaging 0.91
R8003:Plch2 UTSW 4 155054523 missense unknown
R8007:Plch2 UTSW 4 155002831 missense probably damaging 1.00
R8281:Plch2 UTSW 4 155006973 missense probably benign 0.07
R8434:Plch2 UTSW 4 154989735 missense probably damaging 1.00
R8504:Plch2 UTSW 4 154984395 missense probably benign 0.31
R8516:Plch2 UTSW 4 154986307 missense probably benign
R8558:Plch2 UTSW 4 154998934 missense probably damaging 1.00
R8722:Plch2 UTSW 4 154985403 unclassified probably benign
R8768:Plch2 UTSW 4 154998867 missense probably damaging 1.00
R8787:Plch2 UTSW 4 154986418 missense probably benign 0.00
R8826:Plch2 UTSW 4 154986683 missense probably benign 0.00
R8955:Plch2 UTSW 4 154992566 missense probably benign 0.00
R9032:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R9085:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R9423:Plch2 UTSW 4 154986592 missense
R9649:Plch2 UTSW 4 154984059 missense probably benign
R9652:Plch2 UTSW 4 154998485 missense probably benign
R9725:Plch2 UTSW 4 155000535 missense probably damaging 1.00
R9742:Plch2 UTSW 4 154998455 missense probably damaging 0.99
R9789:Plch2 UTSW 4 155010865 critical splice donor site probably null
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-16