Incidental Mutation 'R2265:Agrn'
Institutional Source Beutler Lab
Gene Symbol Agrn
Ensembl Gene ENSMUSG00000041936
Gene Nameagrin
SynonymsNMF380, Agrin, nmf380
MMRRC Submission 040265-MU
Accession Numbers

Genbank: NM_021604; MGI: 87961

Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R2265 (G1)
Quality Score225
Status Not validated
Chromosomal Location156165290-156197488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156179218 bp
Amino Acid Change Glycine to Arginine at position 173 (G173R)
Ref Sequence ENSEMBL: ENSMUSP00000071229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]
Predicted Effect probably damaging
Transcript: ENSMUST00000071248
AA Change: G173R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936
AA Change: G173R

transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1139 5.57e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105574
AA Change: G173R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: G173R

transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1678 6.51e-36 SMART
EGF 1699 1735 4.35e-6 SMART
LamG 1771 1907 5.01e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105575
AA Change: G173R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: G173R

transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1682 9.2e-36 SMART
EGF 1703 1739 4.35e-6 SMART
LamG 1794 1930 5.01e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180572
AA Change: G280R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: G280R

signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181062
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Aox1 C A 1: 58,081,520 D857E probably damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Ddx4 A G 13: 112,621,276 Y290H probably benign Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr164 A G 16: 19,286,555 Y63H probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Zfp616 T C 11: 74,085,463 Y853H possibly damaging Het
Other mutations in Agrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Agrn APN 4 156170572 splice site probably benign
IGL00811:Agrn APN 4 156168774 missense possibly damaging 0.70
IGL01066:Agrn APN 4 156177343 missense probably benign 0.00
IGL01412:Agrn APN 4 156171034 splice site probably benign
IGL01414:Agrn APN 4 156195239 splice site probably null
IGL02075:Agrn APN 4 156170210 missense probably benign 0.40
IGL02609:Agrn APN 4 156175223 splice site probably benign
IGL02669:Agrn APN 4 156174561 splice site probably benign
IGL02671:Agrn APN 4 156174561 splice site probably benign
IGL02672:Agrn APN 4 156174561 splice site probably benign
IGL02674:Agrn APN 4 156174561 splice site probably benign
IGL02724:Agrn APN 4 156172807 nonsense probably null
IGL02804:Agrn APN 4 156174055 missense probably benign 0.00
IGL02986:Agrn APN 4 156178854 missense possibly damaging 0.84
IGL03160:Agrn APN 4 156170363 missense probably damaging 0.98
BB004:Agrn UTSW 4 156172809 missense probably damaging 0.99
BB014:Agrn UTSW 4 156172809 missense probably damaging 0.99
F6893:Agrn UTSW 4 156174179 missense probably benign
R0092:Agrn UTSW 4 156178953 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0482:Agrn UTSW 4 156173555 missense probably damaging 0.98
R0531:Agrn UTSW 4 156179434 missense probably benign 0.38
R0536:Agrn UTSW 4 156179553 missense probably benign 0.01
R0690:Agrn UTSW 4 156174453 missense probably damaging 1.00
R0750:Agrn UTSW 4 156166937 nonsense probably null
R1079:Agrn UTSW 4 156177225 missense probably damaging 1.00
R1199:Agrn UTSW 4 156172299 missense probably benign 0.00
R1222:Agrn UTSW 4 156177385 missense probably damaging 0.99
R1534:Agrn UTSW 4 156176684 missense probably damaging 1.00
R1587:Agrn UTSW 4 156179440 missense probably damaging 0.99
R1625:Agrn UTSW 4 156172860 missense probably damaging 1.00
R1698:Agrn UTSW 4 156166558 missense probably benign 0.03
R1717:Agrn UTSW 4 156166519 frame shift probably null
R1718:Agrn UTSW 4 156166519 frame shift probably null
R1721:Agrn UTSW 4 156175173 nonsense probably null
R1765:Agrn UTSW 4 156176827 nonsense probably null
R1840:Agrn UTSW 4 156167415 missense probably damaging 1.00
R1865:Agrn UTSW 4 156166519 frame shift probably null
R2105:Agrn UTSW 4 156177299 nonsense probably null
R2266:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2269:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2382:Agrn UTSW 4 156176516 missense probably damaging 0.97
R2497:Agrn UTSW 4 156173811 missense probably benign 0.28
R2509:Agrn UTSW 4 156166424 splice site probably null
R2510:Agrn UTSW 4 156166424 splice site probably null
R2511:Agrn UTSW 4 156166424 splice site probably null
R2994:Agrn UTSW 4 156167328 missense possibly damaging 0.79
R3824:Agrn UTSW 4 156169302 missense probably damaging 1.00
R4736:Agrn UTSW 4 156172401 missense probably benign 0.38
R4755:Agrn UTSW 4 156173522 intron probably benign
R4853:Agrn UTSW 4 156185550 critical splice donor site probably null
R4878:Agrn UTSW 4 156170845 missense probably damaging 1.00
R5117:Agrn UTSW 4 156185553 missense probably benign 0.30
R5228:Agrn UTSW 4 156166946 missense probably damaging 1.00
R5236:Agrn UTSW 4 156178858 missense possibly damaging 0.93
R5269:Agrn UTSW 4 156168990 missense probably benign 0.10
R5282:Agrn UTSW 4 156173035 missense probably damaging 1.00
R5449:Agrn UTSW 4 156167280 critical splice donor site probably null
R5560:Agrn UTSW 4 156178497 missense probably damaging 0.99
R5668:Agrn UTSW 4 156167313 missense probably damaging 0.97
R5725:Agrn UTSW 4 156173875 missense probably benign 0.25
R5967:Agrn UTSW 4 156175103 missense probably damaging 1.00
R6226:Agrn UTSW 4 156173609 missense probably damaging 0.96
R6338:Agrn UTSW 4 156170585 missense probably benign 0.17
R6351:Agrn UTSW 4 156179434 missense probably benign 0.00
R6437:Agrn UTSW 4 156176778 missense probably damaging 0.96
R6490:Agrn UTSW 4 156167362 nonsense probably null
R6909:Agrn UTSW 4 156177007 missense possibly damaging 0.90
R7110:Agrn UTSW 4 156178875 missense possibly damaging 0.88
R7123:Agrn UTSW 4 156172840 missense probably benign
R7163:Agrn UTSW 4 156178509 missense probably damaging 1.00
R7180:Agrn UTSW 4 156171839 missense probably benign 0.00
R7251:Agrn UTSW 4 156174606 missense probably damaging 1.00
R7289:Agrn UTSW 4 156178932 missense probably damaging 1.00
R7335:Agrn UTSW 4 156176532 missense probably damaging 1.00
R7336:Agrn UTSW 4 156174914 nonsense probably null
R7406:Agrn UTSW 4 156172301 missense possibly damaging 0.93
R7460:Agrn UTSW 4 156174424 missense probably damaging 0.98
R7531:Agrn UTSW 4 156169804 missense probably damaging 1.00
R7585:Agrn UTSW 4 156170674 missense probably benign 0.08
R7646:Agrn UTSW 4 156195354 missense probably damaging 0.99
R7652:Agrn UTSW 4 156169218 critical splice donor site probably null
R7714:Agrn UTSW 4 156195397 missense probably damaging 1.00
R7751:Agrn UTSW 4 156176429 missense probably damaging 1.00
R7852:Agrn UTSW 4 156169057 missense probably benign 0.01
R7927:Agrn UTSW 4 156172809 missense probably damaging 0.99
R8039:Agrn UTSW 4 156169011 missense probably benign 0.12
R8056:Agrn UTSW 4 156170411 missense probably benign
R8061:Agrn UTSW 4 156178954 missense probably damaging 1.00
R8158:Agrn UTSW 4 156173889 missense probably benign
R8159:Agrn UTSW 4 156172368 missense probably benign 0.27
R8325:Agrn UTSW 4 156173662 missense probably benign 0.01
R8338:Agrn UTSW 4 156168561 missense probably benign 0.01
R8739:Agrn UTSW 4 156172588 missense probably benign
Z1177:Agrn UTSW 4 156171544 nonsense probably null
Z1177:Agrn UTSW 4 156179576 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16