Incidental Mutation 'R2265:Zfp616'
ID244097
Institutional Source Beutler Lab
Gene Symbol Zfp616
Ensembl Gene ENSMUSG00000069476
Gene Namezinc finger protein 616
SynonymsGm12330
MMRRC Submission 040265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2265 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74069955-74087292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74085463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 853 (Y853H)
Ref Sequence ENSEMBL: ENSMUSP00000136549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]
Predicted Effect probably benign
Transcript: ENSMUST00000074813
SMART Domains Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108463
SMART Domains Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 249 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116546
SMART Domains Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137407
Predicted Effect possibly damaging
Transcript: ENSMUST00000178159
AA Change: Y853H

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: Y853H

DomainStartEndE-ValueType
internal_repeat_1 125 447 7.61e-6 PROSPERO
ZnF_C2H2 452 474 3.11e-2 SMART
ZnF_C2H2 509 531 2.61e-4 SMART
ZnF_C2H2 537 559 1.47e-3 SMART
ZnF_C2H2 565 587 5.21e-4 SMART
ZnF_C2H2 593 615 1.22e-4 SMART
ZnF_C2H2 621 643 2.57e-3 SMART
ZnF_C2H2 649 671 9.22e-5 SMART
ZnF_C2H2 677 699 5.9e-3 SMART
ZnF_C2H2 705 727 4.94e-5 SMART
ZnF_C2H2 733 755 8.34e-3 SMART
ZnF_C2H2 761 783 1.6e-4 SMART
ZnF_C2H2 789 811 6.88e-4 SMART
ZnF_C2H2 817 839 1.6e-4 SMART
ZnF_C2H2 845 867 1.3e-4 SMART
ZnF_C2H2 873 895 7.37e-4 SMART
ZnF_C2H2 901 923 1.6e-4 SMART
ZnF_C2H2 929 951 1.3e-4 SMART
ZnF_C2H2 957 979 3.95e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Aox1 C A 1: 58,081,520 D857E probably damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Ddx4 A G 13: 112,621,276 Y290H probably benign Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr164 A G 16: 19,286,555 Y63H probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Other mutations in Zfp616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zfp616 APN 11 74083613 missense probably damaging 0.98
IGL00570:Zfp616 APN 11 74085805 missense probably benign 0.03
IGL00594:Zfp616 APN 11 74082963 missense possibly damaging 0.72
IGL01861:Zfp616 APN 11 74082916 missense possibly damaging 0.53
IGL03022:Zfp616 APN 11 74082974 missense possibly damaging 0.85
R0197:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0442:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R0497:Zfp616 UTSW 11 74083480 missense probably benign 0.00
R0651:Zfp616 UTSW 11 74083729 nonsense probably null
R0730:Zfp616 UTSW 11 74084822 missense probably damaging 1.00
R0883:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0926:Zfp616 UTSW 11 74085818 missense probably benign 0.04
R0940:Zfp616 UTSW 11 74085024 missense probably damaging 1.00
R1068:Zfp616 UTSW 11 74082941 makesense probably null
R1272:Zfp616 UTSW 11 74085236 missense probably benign 0.08
R1446:Zfp616 UTSW 11 74083238 unclassified probably null
R1482:Zfp616 UTSW 11 74083977 missense possibly damaging 0.72
R1553:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R1564:Zfp616 UTSW 11 74084722 missense probably damaging 1.00
R1728:Zfp616 UTSW 11 74085771 missense probably damaging 0.99
R1796:Zfp616 UTSW 11 74085845 missense probably damaging 0.98
R1797:Zfp616 UTSW 11 74085279 nonsense probably null
R1993:Zfp616 UTSW 11 74084969 missense probably benign 0.08
R2026:Zfp616 UTSW 11 74083587 missense possibly damaging 0.86
R2124:Zfp616 UTSW 11 74083043 unclassified probably null
R2126:Zfp616 UTSW 11 74085403 missense probably benign 0.08
R2199:Zfp616 UTSW 11 74084630 missense possibly damaging 0.58
R2404:Zfp616 UTSW 11 74084856 missense probably damaging 1.00
R2508:Zfp616 UTSW 11 74083295 missense probably benign 0.01
R2519:Zfp616 UTSW 11 74084268 nonsense probably null
R3103:Zfp616 UTSW 11 74071735 missense probably benign 0.01
R3611:Zfp616 UTSW 11 74083442 missense possibly damaging 0.53
R3703:Zfp616 UTSW 11 74083319 nonsense probably null
R3744:Zfp616 UTSW 11 74083987 missense probably benign 0.01
R4043:Zfp616 UTSW 11 74085282 missense possibly damaging 0.50
R4273:Zfp616 UTSW 11 74083700 missense probably benign 0.00
R4384:Zfp616 UTSW 11 74083179 missense possibly damaging 0.94
R4469:Zfp616 UTSW 11 74071124 missense probably damaging 0.98
R4560:Zfp616 UTSW 11 74083034 missense probably benign 0.00
R4821:Zfp616 UTSW 11 74084207 missense probably benign 0.41
R4844:Zfp616 UTSW 11 74084399 missense probably benign 0.10
R4948:Zfp616 UTSW 11 74084004 missense possibly damaging 0.72
R5007:Zfp616 UTSW 11 74083817 missense possibly damaging 0.96
R5198:Zfp616 UTSW 11 74083510 missense probably benign 0.33
R5344:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R5918:Zfp616 UTSW 11 74083260 missense possibly damaging 0.70
R5933:Zfp616 UTSW 11 74083126 missense probably damaging 0.96
R6084:Zfp616 UTSW 11 74083846 nonsense probably null
R6421:Zfp616 UTSW 11 74083870 missense possibly damaging 0.53
R6494:Zfp616 UTSW 11 74085192 missense probably damaging 1.00
R6523:Zfp616 UTSW 11 74083142 missense possibly damaging 0.79
R6849:Zfp616 UTSW 11 74085450 missense possibly damaging 0.70
R6910:Zfp616 UTSW 11 74085002 missense probably damaging 1.00
R7146:Zfp616 UTSW 11 74085261 missense possibly damaging 0.61
R7213:Zfp616 UTSW 11 74085863 missense probably benign 0.05
R7302:Zfp616 UTSW 11 74085379 missense probably benign 0.08
R7391:Zfp616 UTSW 11 74085329 missense probably benign 0.08
R7654:Zfp616 UTSW 11 74083187 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAAGTCTTAAAAGGCACCACAGA -3'
(R):5'- CTTGAAGATTTGAATACTGGGCAAAA -3'

Sequencing Primer
(F):5'- GCCCAGTCTTCAAATCTTCAAG -3'
(R):5'- CTTGAAGATTTGAAGACTGGGC -3'
Posted On2014-10-16