Mutagenetix > Incidental Mutations

Incidental Mutation 'R2265:Mrc2'

244098

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

040265-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2265 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 105348431 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

Predicted Effect

probably benign
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100335

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578C19Rik	A	G	X: 18,423,687	S179P	possibly damaging	Het
A830018L16Rik	T	C	1: 11,972,104		probably null	Het
Aadac	T	A	3: 60,037,316	D136E	probably damaging	Het
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Adam24	T	A	8: 40,680,071	S193T	possibly damaging	Het
Adra2b	T	C	2: 127,363,871	S103P	probably damaging	Het
Agrn	C	T	4: 156,179,218	G173R	probably damaging	Het
Alg11	T	A	8: 22,065,614	V255E	probably benign	Het
Aox1	C	A	1: 58,081,520	D857E	probably damaging	Het
Apob	T	C	12: 8,015,475	F4115S	possibly damaging	Het
Bdkrb2	A	G	12: 105,592,225	T242A	probably benign	Het
Cdca7	T	C	2: 72,482,490	L190P	probably benign	Het
Cenpe	A	G	3: 135,261,636	T2180A	probably benign	Het
Cep41	T	A	6: 30,660,916	I126F	possibly damaging	Het
Col16a1	C	A	4: 130,052,918	H111Q	probably benign	Het
Cops3	T	C	11: 59,827,890	T193A	probably benign	Het
Dbr1	G	A	9: 99,579,410	V153M	probably damaging	Het
Ddx4	A	G	13: 112,621,276	Y290H	probably benign	Het
Dgkb	T	A	12: 38,190,108	S461R	possibly damaging	Het
Dnajc28	T	C	16: 91,616,312	N372S	probably benign	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock3	C	A	9: 106,941,326	V1190F	probably damaging	Het
Exosc1	A	G	19: 41,931,418	S54P	probably damaging	Het
Fbxw22	C	T	9: 109,383,994	R295K	probably benign	Het
Foxo1	T	C	3: 52,345,912	S499P	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hspa2	T	G	12: 76,406,188	I552S	probably benign	Het
Imp4	T	A	1: 34,443,847	I173N	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Kcnh6	G	A	11: 106,033,817	R816Q	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Kcnip3	G	T	2: 127,465,061	A173D	probably benign	Het
Kir3dl1	A	G	X: 136,525,035	R53G	probably benign	Het
Klhl31	A	G	9: 77,650,158	D52G	possibly damaging	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lilrb4a	T	A	10: 51,491,537	Y58*	probably null	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mpdz	A	G	4: 81,383,391	S266P	probably damaging	Het
Mroh7	T	C	4: 106,720,927	N185D	probably benign	Het
Mybphl	A	G	3: 108,365,001	E2G	probably damaging	Het
Mycbp2	T	C	14: 103,262,749	D937G	probably benign	Het
Myo18b	A	G	5: 112,782,673	M1799T	probably damaging	Het
Nr4a2	T	A	2: 57,112,006	D145V	possibly damaging	Het
Ntmt1	C	A	2: 30,820,460	N58K	probably benign	Het
Olfr1066	T	C	2: 86,456,214	Y19C	possibly damaging	Het
Olfr1278	A	G	2: 111,293,179	T304A	probably benign	Het
Olfr1330	A	T	4: 118,893,874	R264W	probably damaging	Het
Olfr164	A	G	16: 19,286,555	Y63H	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Olfr659	T	C	7: 104,670,860	F53L	probably benign	Het
Ovch2	A	T	7: 107,784,575	M521K	probably damaging	Het
P2ry13	T	C	3: 59,210,028	M110V	probably damaging	Het
P2ry14	T	C	3: 59,115,571	N165S	probably damaging	Het
Pcdhb19	A	T	18: 37,497,683	H177L	probably damaging	Het
Phf8	T	C	X: 151,572,601	L520S	possibly damaging	Het
Pjvk	T	G	2: 76,657,453	S230A	possibly damaging	Het
Plch2	T	C	4: 154,993,004	E423G	probably benign	Het
Rad9b	T	C	5: 122,351,342	Y41C	probably damaging	Het
Ranbp3l	A	T	15: 9,057,113	I286F	probably damaging	Het
Rtel1	T	A	2: 181,354,368	V739D	probably damaging	Het
Slc35a3	T	C	3: 116,673,636	K325E	possibly damaging	Het
Spag17	C	A	3: 100,061,866		probably null	Het
Spg11	A	T	2: 122,108,307	C389S	possibly damaging	Het
Srsf4	T	C	4: 131,897,682	V130A	probably damaging	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Tas2r117	T	A	6: 132,803,225	C109S	probably benign	Het
Tlr5	T	A	1: 182,975,035	S635T	possibly damaging	Het
Ttc21a	G	T	9: 119,959,008	C833F	possibly damaging	Het
Vash2	T	C	1: 190,950,213	N347D	probably damaging	Het
Vcp	G	A	4: 42,980,833	A759V	possibly damaging	Het
Vmn2r18	T	C	5: 151,586,662	E82G	probably damaging	Het
Vps13c	T	C	9: 67,920,947	V1461A	possibly damaging	Het
Zfp616	T	C	11: 74,085,463	Y853H	possibly damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGAGCTGCCAGAGAAGAGTG -3'
(R):5'- CTGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'

Posted On

2014-10-16