Incidental Mutation 'R0277:Sv2b'
ID24411
Institutional Source Beutler Lab
Gene Symbol Sv2b
Ensembl Gene ENSMUSG00000053025
Gene Namesynaptic vesicle glycoprotein 2 b
SynonymsA830038F04Rik
MMRRC Submission 038499-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0277 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location75114894-75309262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75206439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 34 (D34E)
Ref Sequence ENSEMBL: ENSMUSP00000146049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085164
AA Change: D34E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025
AA Change: D34E

DomainStartEndE-ValueType
Pfam:Sugar_tr 93 415 3.8e-29 PFAM
Pfam:MFS_1 111 429 9.3e-25 PFAM
Pfam:MFS_1 517 681 8.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165175
AA Change: D34E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025
AA Change: D34E

DomainStartEndE-ValueType
Pfam:Sugar_tr 89 412 1.5e-29 PFAM
Pfam:MFS_1 111 429 9.5e-25 PFAM
Pfam:Pentapeptide_4 453 528 7.9e-11 PFAM
Pfam:MFS_1 516 681 5.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206236
Predicted Effect possibly damaging
Transcript: ENSMUST00000206344
AA Change: D34E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.3%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik A G 7: 125,318,643 K69R unknown Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Acad11 T C 9: 104,124,025 M708T probably damaging Het
Adam7 T C 14: 68,510,857 probably null Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Ak3 A G 19: 29,047,792 M13T possibly damaging Het
Ap2s1 T C 7: 16,747,380 probably benign Het
Arhgef1 A T 7: 24,923,799 probably benign Het
Arsk T C 13: 76,074,932 N182S probably benign Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Atp8b3 T C 10: 80,526,909 K672E probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Casp6 T A 3: 129,910,523 V86E probably benign Het
Cdca5 A G 19: 6,090,712 E260G unknown Het
Cpb2 T A 14: 75,265,458 V159D probably damaging Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dync2h1 T C 9: 7,129,046 D1823G probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgbp G T 7: 28,085,493 probably null Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Gldc A G 19: 30,116,451 I722T possibly damaging Het
Gm10717 T G 9: 3,025,619 V68G possibly damaging Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gnl3 A C 14: 31,013,427 probably null Het
Gsto1 A T 19: 47,857,977 I88F probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hipk3 T A 2: 104,441,248 L446F probably damaging Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hsd17b6 T C 10: 127,991,405 D266G probably benign Het
Ipo4 T C 14: 55,632,115 S363G probably benign Het
Kcnip3 A G 2: 127,459,979 probably benign Het
Klhl41 A G 2: 69,671,296 Y367C probably damaging Het
Klk1b4 C G 7: 44,211,629 P232R possibly damaging Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Mark1 A G 1: 184,944,952 S34P possibly damaging Het
Megf11 G A 9: 64,691,350 probably null Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Muc4 C A 16: 32,755,690 probably benign Het
Myo18b A G 5: 112,693,347 probably benign Het
Myo9b T C 8: 71,355,952 probably benign Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg3 A G 2: 156,934,935 probably benign Het
Nfe2l3 T A 6: 51,457,468 M336K probably benign Het
Nrxn1 A C 17: 90,700,742 probably null Het
Nsun3 A T 16: 62,776,644 probably benign Het
Nuak1 T C 10: 84,374,451 E591G probably benign Het
Olfr1347 T A 7: 6,488,434 M147L probably benign Het
Olfr1511 T C 14: 52,390,389 Y128C probably damaging Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr730 T C 14: 50,186,332 N296S probably null Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Olfr982 G A 9: 40,074,714 V140I probably benign Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Ovgp1 T C 3: 105,979,892 probably benign Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pdk4 G T 6: 5,491,620 P100Q probably damaging Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Prune2 A T 19: 17,121,389 D1419V probably damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Rab11fip4 A G 11: 79,686,629 H403R possibly damaging Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Ric8a T G 7: 140,857,900 probably benign Het
Rsbn1 T C 3: 103,914,581 F44S possibly damaging Het
Serpinc1 T A 1: 160,989,702 M1K probably null Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Sipa1 A T 19: 5,654,065 M743K probably benign Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slco6b1 A T 1: 96,988,673 noncoding transcript Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Sort1 T C 3: 108,324,592 probably benign Het
Spg21 A T 9: 65,465,347 K20N possibly damaging Het
Sptbn2 A T 19: 4,745,145 I1544F probably benign Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Ssbp2 T A 13: 91,564,596 probably benign Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Synpo2l A G 14: 20,661,788 S255P probably damaging Het
Tbx15 C T 3: 99,352,391 P526L probably damaging Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tgm1 C A 14: 55,710,927 probably benign Het
Tgm1 T C 14: 55,712,652 probably benign Het
Thsd7b A G 1: 130,195,263 I1540V probably benign Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Ube2l6 A T 2: 84,806,427 probably null Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Wdfy4 T C 14: 33,083,785 D1735G possibly damaging Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wnt5a A T 14: 28,513,268 M70L possibly damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfp455 G T 13: 67,198,664 probably null Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Sv2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01463:Sv2b APN 7 75136455 missense probably damaging 1.00
IGL02302:Sv2b APN 7 75124199 missense probably damaging 0.98
IGL02352:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02359:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02698:Sv2b APN 7 75140978 critical splice donor site probably null
IGL02713:Sv2b APN 7 75124163 missense possibly damaging 0.66
IGL03075:Sv2b APN 7 75136320 missense probably benign
IGL03392:Sv2b APN 7 75156760 critical splice acceptor site probably null
R0015:Sv2b UTSW 7 75125641 missense probably damaging 1.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0219:Sv2b UTSW 7 75157267 critical splice donor site probably null
R0469:Sv2b UTSW 7 75136392 missense probably benign
R0510:Sv2b UTSW 7 75136392 missense probably benign
R1219:Sv2b UTSW 7 75136412 missense probably benign 0.01
R1307:Sv2b UTSW 7 75206434 missense probably damaging 1.00
R1476:Sv2b UTSW 7 75120043 missense possibly damaging 0.72
R1520:Sv2b UTSW 7 75157329 missense probably damaging 0.98
R1575:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1585:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1666:Sv2b UTSW 7 75206341 missense probably benign 0.01
R1712:Sv2b UTSW 7 75149059 missense possibly damaging 0.78
R1864:Sv2b UTSW 7 75124080 missense probably benign 0.17
R1993:Sv2b UTSW 7 75206341 missense probably benign 0.01
R2191:Sv2b UTSW 7 75124088 missense probably damaging 1.00
R3836:Sv2b UTSW 7 75157428 missense probably damaging 1.00
R4744:Sv2b UTSW 7 75206518 missense probably benign 0.01
R4757:Sv2b UTSW 7 75124170 missense probably benign 0.31
R4924:Sv2b UTSW 7 75136421 missense probably benign 0.20
R4990:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R4991:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R5038:Sv2b UTSW 7 75157425 missense probably damaging 1.00
R5726:Sv2b UTSW 7 75124214 missense possibly damaging 0.67
R5885:Sv2b UTSW 7 75156753 missense probably damaging 1.00
R6379:Sv2b UTSW 7 75136300 missense possibly damaging 0.73
R6410:Sv2b UTSW 7 75140109 missense probably benign 0.40
R6623:Sv2b UTSW 7 75206384 missense probably damaging 1.00
R6709:Sv2b UTSW 7 75124139 missense probably benign 0.40
R6873:Sv2b UTSW 7 75206206 missense probably damaging 1.00
R6889:Sv2b UTSW 7 75125767 intron probably null
R7123:Sv2b UTSW 7 75117702 missense possibly damaging 0.94
R7278:Sv2b UTSW 7 75147654 missense probably damaging 0.99
R7363:Sv2b UTSW 7 75147654 missense probably damaging 0.99
R7378:Sv2b UTSW 7 75147728 critical splice acceptor site probably null
R7426:Sv2b UTSW 7 75124064 missense probably damaging 1.00
R7452:Sv2b UTSW 7 75147713 missense probably damaging 1.00
R7504:Sv2b UTSW 7 75136383 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGCCACACTCATCAATGATGGTCTC -3'
(R):5'- AGTTACTCCCAGCACAAGCCTCTG -3'

Sequencing Primer
(F):5'- ATATTGGTGAGCCAGCTCC -3'
(R):5'- CACAAGCCTCTGGGTCATATAAGG -3'
Posted On2013-04-16