Incidental Mutation 'R2265:Olfr164'
Institutional Source Beutler Lab
Gene Symbol Olfr164
Ensembl Gene ENSMUSG00000050742
Gene Nameolfactory receptor 164
SynonymsGA_x54KRFPKG5P-15738260-15737319, MOR279-2
MMRRC Submission 040265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2265 (G1)
Quality Score225
Status Not validated
Chromosomal Location19284104-19314064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19286555 bp
Amino Acid Change Tyrosine to Histidine at position 63 (Y63H)
Ref Sequence ENSEMBL: ENSMUSP00000149971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056727] [ENSMUST00000216157]
Predicted Effect probably damaging
Transcript: ENSMUST00000056727
AA Change: Y63H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056970
Gene: ENSMUSG00000050742
AA Change: Y63H

Pfam:7tm_4 32 311 2.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.2e-8 PFAM
Pfam:7tm_1 44 293 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216157
AA Change: Y63H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Aox1 C A 1: 58,081,520 D857E probably damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Ddx4 A G 13: 112,621,276 Y290H probably benign Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Zfp616 T C 11: 74,085,463 Y853H possibly damaging Het
Other mutations in Olfr164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Olfr164 APN 16 19286700 missense probably benign 0.01
IGL01569:Olfr164 APN 16 19286660 missense probably benign 0.28
IGL01619:Olfr164 APN 16 19286159 missense probably damaging 1.00
IGL02101:Olfr164 APN 16 19286613 missense probably benign
IGL02201:Olfr164 APN 16 19286462 missense probably benign 0.03
IGL02730:Olfr164 APN 16 19286682 missense probably benign 0.00
IGL03228:Olfr164 APN 16 19286390 missense probably damaging 1.00
R1566:Olfr164 UTSW 16 19286327 missense possibly damaging 0.76
R1817:Olfr164 UTSW 16 19285877 missense probably damaging 1.00
R1870:Olfr164 UTSW 16 19286607 missense probably damaging 1.00
R1918:Olfr164 UTSW 16 19286302 missense probably benign 0.03
R2202:Olfr164 UTSW 16 19286297 missense probably benign 0.03
R3792:Olfr164 UTSW 16 19285946 missense possibly damaging 0.54
R4285:Olfr164 UTSW 16 19285964 missense probably damaging 1.00
R4961:Olfr164 UTSW 16 19285976 missense probably damaging 1.00
R5022:Olfr164 UTSW 16 19286059 missense probably damaging 1.00
R5432:Olfr164 UTSW 16 19286089 missense probably benign 0.06
R5827:Olfr164 UTSW 16 19286432 missense probably benign 0.24
R6154:Olfr164 UTSW 16 19286431 missense probably damaging 0.99
R6188:Olfr164 UTSW 16 19286557 missense probably damaging 1.00
R6367:Olfr164 UTSW 16 19286072 missense probably damaging 1.00
R8508:Olfr164 UTSW 16 19286701 missense probably benign 0.01
R8523:Olfr164 UTSW 16 19286101 missense probably benign 0.13
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16