Incidental Mutation 'R2265:Kcnh8'
ID 244115
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, Kv12.1, C130090D05Rik
MMRRC Submission 040265-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2265 (G1)
Quality Score 143
Status Not validated
Chromosome 17
Chromosomal Location 52909737-53286222 bp(+) (GRCm39)
Type of Mutation small deletion (8 aa in frame mutation)
DNA Base Change (assembly) GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA at 53032934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 74 (74)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039366
AA Change: 74
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: 74

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 12,042,328 (GRCm39) probably null Het
Aadac T A 3: 59,944,737 (GRCm39) D136E probably damaging Het
Abca16 A G 7: 120,030,383 (GRCm39) D165G probably benign Het
Adam24 T A 8: 41,133,110 (GRCm39) S193T possibly damaging Het
Adra2b T C 2: 127,205,791 (GRCm39) S103P probably damaging Het
Agrn C T 4: 156,263,675 (GRCm39) G173R probably damaging Het
Alg11 T A 8: 22,555,630 (GRCm39) V255E probably benign Het
Aox1 C A 1: 58,120,679 (GRCm39) D857E probably damaging Het
Apob T C 12: 8,065,475 (GRCm39) F4115S possibly damaging Het
Bdkrb2 A G 12: 105,558,484 (GRCm39) T242A probably benign Het
Cdca7 T C 2: 72,312,834 (GRCm39) L190P probably benign Het
Cenpe A G 3: 134,967,397 (GRCm39) T2180A probably benign Het
Cep41 T A 6: 30,660,915 (GRCm39) I126F possibly damaging Het
Col16a1 C A 4: 129,946,711 (GRCm39) H111Q probably benign Het
Cops3 T C 11: 59,718,716 (GRCm39) T193A probably benign Het
Dbr1 G A 9: 99,461,463 (GRCm39) V153M probably damaging Het
Ddx4 A G 13: 112,757,810 (GRCm39) Y290H probably benign Het
Dgkb T A 12: 38,240,107 (GRCm39) S461R possibly damaging Het
Dipk2b A G X: 18,289,926 (GRCm39) S179P possibly damaging Het
Dnajc28 T C 16: 91,413,200 (GRCm39) N372S probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,563,270 (GRCm39) probably benign Het
Dock3 C A 9: 106,818,525 (GRCm39) V1190F probably damaging Het
Exosc1 A G 19: 41,919,857 (GRCm39) S54P probably damaging Het
Fbxw22 C T 9: 109,213,062 (GRCm39) R295K probably benign Het
Foxo1 T C 3: 52,253,333 (GRCm39) S499P probably benign Het
Heatr5a T C 12: 51,940,528 (GRCm39) D1444G possibly damaging Het
Hspa2 T G 12: 76,452,962 (GRCm39) I552S probably benign Het
Imp4 T A 1: 34,482,928 (GRCm39) I173N probably damaging Het
Itgal A G 7: 126,905,873 (GRCm39) I352V possibly damaging Het
Kcnh6 G A 11: 105,924,643 (GRCm39) R816Q probably benign Het
Kcnip3 G T 2: 127,306,981 (GRCm39) A173D probably benign Het
Kir3dl1 A G X: 135,425,784 (GRCm39) R53G probably benign Het
Klhl31 A G 9: 77,557,440 (GRCm39) D52G possibly damaging Het
Klk1b21 T C 7: 43,753,863 (GRCm39) I49T possibly damaging Het
Lama2 T A 10: 26,868,932 (GRCm39) I2838F probably damaging Het
Lilrb4a T A 10: 51,367,633 (GRCm39) Y58* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Mpdz A G 4: 81,301,628 (GRCm39) S266P probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,124 (GRCm39) N185D probably benign Het
Mybphl A G 3: 108,272,317 (GRCm39) E2G probably damaging Het
Mycbp2 T C 14: 103,500,185 (GRCm39) D937G probably benign Het
Myo18b A G 5: 112,930,539 (GRCm39) M1799T probably damaging Het
Nr4a2 T A 2: 57,002,018 (GRCm39) D145V possibly damaging Het
Ntmt1 C A 2: 30,710,472 (GRCm39) N58K probably benign Het
Or10ak16 A T 4: 118,751,071 (GRCm39) R264W probably damaging Het
Or2m12 A G 16: 19,105,305 (GRCm39) Y63H probably damaging Het
Or4f54 A G 2: 111,123,524 (GRCm39) T304A probably benign Het
Or51f1d G A 7: 102,701,344 (GRCm39) V280I probably benign Het
Or52n20 T C 7: 104,320,067 (GRCm39) F53L probably benign Het
Or8k28 T C 2: 86,286,558 (GRCm39) Y19C possibly damaging Het
Ovch2 A T 7: 107,383,782 (GRCm39) M521K probably damaging Het
P2ry13 T C 3: 59,117,449 (GRCm39) M110V probably damaging Het
P2ry14 T C 3: 59,022,992 (GRCm39) N165S probably damaging Het
Pcdhb19 A T 18: 37,630,736 (GRCm39) H177L probably damaging Het
Phf8 T C X: 150,355,597 (GRCm39) L520S possibly damaging Het
Pjvk T G 2: 76,487,797 (GRCm39) S230A possibly damaging Het
Plch2 T C 4: 155,077,461 (GRCm39) E423G probably benign Het
Rad9b T C 5: 122,489,405 (GRCm39) Y41C probably damaging Het
Ranbp3l A T 15: 9,057,194 (GRCm39) I286F probably damaging Het
Rtel1 T A 2: 180,996,161 (GRCm39) V739D probably damaging Het
Slc35a3 T C 3: 116,467,285 (GRCm39) K325E possibly damaging Het
Spag17 C A 3: 99,969,182 (GRCm39) probably null Het
Spg11 A T 2: 121,938,788 (GRCm39) C389S possibly damaging Het
Srsf4 T C 4: 131,624,993 (GRCm39) V130A probably damaging Het
Taar8b T C 10: 23,967,270 (GRCm39) N308S probably damaging Het
Tas2r117 T A 6: 132,780,188 (GRCm39) C109S probably benign Het
Tlr5 T A 1: 182,802,600 (GRCm39) S635T possibly damaging Het
Ttc21a G T 9: 119,788,074 (GRCm39) C833F possibly damaging Het
Vash2 T C 1: 190,682,410 (GRCm39) N347D probably damaging Het
Vcp G A 4: 42,980,833 (GRCm39) A759V possibly damaging Het
Vmn2r18 T C 5: 151,510,127 (GRCm39) E82G probably damaging Het
Vps13c T C 9: 67,828,229 (GRCm39) V1461A possibly damaging Het
Zfp616 T C 11: 73,976,289 (GRCm39) Y853H possibly damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 53,141,708 (GRCm39) missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 53,201,148 (GRCm39) splice site probably benign
IGL01959:Kcnh8 APN 17 53,141,635 (GRCm39) missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 53,184,939 (GRCm39) missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 53,110,556 (GRCm39) missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 53,205,525 (GRCm39) missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 53,266,471 (GRCm39) missense probably benign 0.00
IGL02931:Kcnh8 APN 17 53,263,650 (GRCm39) missense probably benign 0.00
IGL02950:Kcnh8 APN 17 53,263,795 (GRCm39) missense probably benign 0.22
Incompetent UTSW 17 53,201,129 (GRCm39) missense probably damaging 1.00
leak UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R0282:Kcnh8 UTSW 17 53,032,879 (GRCm39) missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 53,284,648 (GRCm39) splice site probably null
R0496:Kcnh8 UTSW 17 53,032,886 (GRCm39) missense probably benign 0.19
R0601:Kcnh8 UTSW 17 53,201,033 (GRCm39) missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 53,285,141 (GRCm39) nonsense probably null
R0891:Kcnh8 UTSW 17 53,212,242 (GRCm39) missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 53,032,927 (GRCm39) missense probably benign 0.00
R1054:Kcnh8 UTSW 17 53,110,512 (GRCm39) missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 53,200,989 (GRCm39) missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 53,200,988 (GRCm39) missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 53,263,909 (GRCm39) missense probably benign
R1657:Kcnh8 UTSW 17 53,146,153 (GRCm39) missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 53,200,996 (GRCm39) missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 53,200,961 (GRCm39) missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1804:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1929:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1980:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1981:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1982:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2016:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2017:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2132:Kcnh8 UTSW 17 53,200,961 (GRCm39) missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 53,200,961 (GRCm39) missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2266:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2267:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2303:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2309:Kcnh8 UTSW 17 53,285,067 (GRCm39) missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2764:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2857:Kcnh8 UTSW 17 53,284,961 (GRCm39) missense probably benign
R2898:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2987:Kcnh8 UTSW 17 53,263,763 (GRCm39) missense probably benign 0.05
R3031:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R3157:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R3158:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4080:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4081:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4082:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4087:Kcnh8 UTSW 17 53,110,428 (GRCm39) missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4158:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4213:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4301:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4302:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4383:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4385:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4400:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4490:Kcnh8 UTSW 17 53,268,905 (GRCm39) critical splice donor site probably null
R4493:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4494:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4611:Kcnh8 UTSW 17 52,909,864 (GRCm39) missense probably benign 0.22
R4728:Kcnh8 UTSW 17 53,032,898 (GRCm39) missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 53,212,248 (GRCm39) splice site probably null
R4927:Kcnh8 UTSW 17 53,185,009 (GRCm39) missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 53,184,995 (GRCm39) missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 53,200,958 (GRCm39) missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 53,205,486 (GRCm39) missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 53,212,043 (GRCm39) missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 53,033,023 (GRCm39) missense probably benign 0.10
R5472:Kcnh8 UTSW 17 53,284,844 (GRCm39) missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 53,033,008 (GRCm39) missense probably benign 0.00
R5714:Kcnh8 UTSW 17 53,285,150 (GRCm39) missense probably benign 0.31
R5866:Kcnh8 UTSW 17 53,263,804 (GRCm39) missense probably benign 0.05
R5903:Kcnh8 UTSW 17 53,110,364 (GRCm39) missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 53,184,971 (GRCm39) nonsense probably null
R6994:Kcnh8 UTSW 17 53,284,723 (GRCm39) missense probably benign 0.02
R7101:Kcnh8 UTSW 17 53,212,038 (GRCm39) missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 53,201,145 (GRCm39) splice site probably null
R7228:Kcnh8 UTSW 17 53,263,744 (GRCm39) missense probably benign 0.01
R7372:Kcnh8 UTSW 17 53,201,129 (GRCm39) missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 53,268,871 (GRCm39) missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 53,263,743 (GRCm39) missense probably benign
R7952:Kcnh8 UTSW 17 53,266,493 (GRCm39) missense probably benign 0.02
R8176:Kcnh8 UTSW 17 53,285,122 (GRCm39) missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 53,263,936 (GRCm39) missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 53,212,101 (GRCm39) missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 53,285,320 (GRCm39) missense probably benign
R8716:Kcnh8 UTSW 17 53,284,780 (GRCm39) missense probably benign 0.02
R8943:Kcnh8 UTSW 17 53,104,486 (GRCm39) missense probably benign 0.00
R9051:Kcnh8 UTSW 17 53,141,642 (GRCm39) missense probably damaging 1.00
R9211:Kcnh8 UTSW 17 53,146,236 (GRCm39) missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 53,285,168 (GRCm39) missense probably damaging 1.00
R9243:Kcnh8 UTSW 17 53,205,542 (GRCm39) missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 53,146,084 (GRCm39) missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 53,185,089 (GRCm39) missense probably damaging 1.00
R9646:Kcnh8 UTSW 17 53,104,573 (GRCm39) missense probably benign 0.25
RF009:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF010:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF011:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF021:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF022:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 53,285,320 (GRCm39) missense probably benign
Z1088:Kcnh8 UTSW 17 53,032,918 (GRCm39) missense probably damaging 1.00
Z1176:Kcnh8 UTSW 17 53,201,089 (GRCm39) missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 53,285,121 (GRCm39) missense possibly damaging 0.91
Z1177:Kcnh8 UTSW 17 53,110,499 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGACTGAAGTTGTGTCTTAAAC -3'
(R):5'- ATGTTCCCTGGAGAACTTCTC -3'

Sequencing Primer
(F):5'- GACTGAAGTTGTGTCTTAAACAAAAG -3'
(R):5'- CTTCTCCCAAACACTATAATTGAGTG -3'
Posted On 2014-10-16