Incidental Mutation 'R1327:Smad7'
ID244121
Institutional Source Beutler Lab
Gene Symbol Smad7
Ensembl Gene ENSMUSG00000025880
Gene NameSMAD family member 7
SynonymsMadh7
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R1327 (G1)
Quality Score36
Status Validated
Chromosome18
Chromosomal Location75367529-75395935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75375945 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 48 (S48P)
Ref Sequence ENSEMBL: ENSMUSP00000133696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026999] [ENSMUST00000168918] [ENSMUST00000174411]
Predicted Effect probably benign
Transcript: ENSMUST00000026999
AA Change: S247P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026999
Gene: ENSMUSG00000025880
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 20 65 N/A INTRINSIC
DWA 87 205 5.36e-51 SMART
DWB 259 424 2.46e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168918
AA Change: S247P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129322
Gene: ENSMUSG00000025880
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 20 65 N/A INTRINSIC
DWA 87 205 5.36e-51 SMART
DWB 259 424 2.46e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172718
Predicted Effect probably benign
Transcript: ENSMUST00000174411
AA Change: S48P

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133696
Gene: ENSMUSG00000025880
AA Change: S48P

DomainStartEndE-ValueType
DWB 60 225 2.46e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174843
SMART Domains Protein: ENSMUSP00000133544
Gene: ENSMUSG00000025880

DomainStartEndE-ValueType
low complexity region 9 54 N/A INTRINSIC
DWA 76 194 5.36e-51 SMART
Pfam:MH2 222 264 4.3e-7 PFAM
Meta Mutation Damage Score 0.3021 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that binds the E3 ubiquitin ligase SMURF2. Upon binding, this complex translocates to the cytoplasm, where it interacts with TGF-beta receptor type-1 (TGFBR1), leading to the degradation of both the encoded protein and TGFBR1. Expression of this gene is induced by TGFBR1. Variations in this gene are a cause of susceptibility to colorectal cancer type 3 (CRCS3). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele display partial penetrance of prenatal lethality, reduced body size and weight, smaller litter size and B cell abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Smad7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0790:Smad7 UTSW 18 75393862 missense probably benign 0.06
R2026:Smad7 UTSW 18 75394154 missense probably damaging 1.00
R4398:Smad7 UTSW 18 75394163 missense probably damaging 1.00
R7564:Smad7 UTSW 18 75393835 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTCTGTGATTGAGCCTGACCTGAC -3'
(R):5'- AACACAGTTCCCAGGTGACTCCAG -3'

Sequencing Primer
(F):5'- GATTGAGCCTGACCTGACTAATG -3'
(R):5'- ATGGGCAAGGTTCTGGCAC -3'
Posted On2014-10-17