Incidental Mutation 'R1248:Il4i1'
ID244127
Institutional Source Beutler Lab
Gene Symbol Il4i1
Ensembl Gene ENSMUSG00000074141
Gene Nameinterleukin 4 induced 1
SynonymsFig1-ps, Fig1
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1248 (G1)
Quality Score77
Status Validated
Chromosome7
Chromosomal Location44816387-44840809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44839789 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 334 (R334L)
Ref Sequence ENSEMBL: ENSMUSP00000113726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000118125] [ENSMUST00000145959]
Predicted Effect probably damaging
Transcript: ENSMUST00000033015
AA Change: R326L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141
AA Change: R326L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118125
AA Change: R334L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141
AA Change: R334L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153161
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Meta Mutation Damage Score 0.3026 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Il4i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Il4i1 APN 7 44838046 nonsense probably null
IGL03366:Il4i1 APN 7 44837495 unclassified probably benign
R0945:Il4i1 UTSW 7 44839704 missense probably damaging 1.00
R1559:Il4i1 UTSW 7 44839387 missense probably damaging 0.98
R2099:Il4i1 UTSW 7 44838192 critical splice donor site probably null
R2131:Il4i1 UTSW 7 44840070 missense probably damaging 0.98
R2212:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R2516:Il4i1 UTSW 7 44839891 missense probably damaging 1.00
R2893:Il4i1 UTSW 7 44837990 missense probably damaging 0.98
R3412:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R3414:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R5493:Il4i1 UTSW 7 44840053 missense possibly damaging 0.56
R6156:Il4i1 UTSW 7 44840184 missense possibly damaging 0.53
R6239:Il4i1 UTSW 7 44840412 missense probably benign
R6422:Il4i1 UTSW 7 44840136 missense probably damaging 0.99
R6813:Il4i1 UTSW 7 44839812 missense probably benign 0.44
R6866:Il4i1 UTSW 7 44836539 critical splice donor site probably null
R7543:Il4i1 UTSW 7 44836775 missense possibly damaging 0.79
R7673:Il4i1 UTSW 7 44840362 missense probably benign
R7965:Il4i1 UTSW 7 44840395 missense probably benign
R8848:Il4i1 UTSW 7 44839751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGTACAGCCGCATCGTAGG -3'
(R):5'- ACCAGTCATAGTCCTCAGCCTCGC -3'

Sequencing Primer
(F):5'- CATCGTAGGTGGCTGGGAC -3'
(R):5'- AAACGCAGGGTCTGGTC -3'
Posted On2014-10-20