Incidental Mutation 'R2287:Ndufa8'
ID244145
Institutional Source Beutler Lab
Gene Symbol Ndufa8
Ensembl Gene ENSMUSG00000026895
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8
Synonyms0610033L03Rik
MMRRC Submission 040286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2287 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36036326-36049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36036542 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 161 (A161T)
Ref Sequence ENSEMBL: ENSMUSP00000065352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070112]
Predicted Effect probably benign
Transcript: ENSMUST00000070112
AA Change: A161T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065352
Gene: ENSMUSG00000026895
AA Change: A161T

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:CHCH 78 113 3.6e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Clec4f CTT CT 6: 83,653,265 probably null Het
Dis3l T A 9: 64,307,497 Q930L probably benign Het
Edem2 T C 2: 155,713,359 K275E probably benign Het
Ehf T C 2: 103,267,124 I193V possibly damaging Het
Gsdma3 A G 11: 98,638,004 N428S possibly damaging Het
Gtf2h4 C A 17: 35,671,225 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Naalad2 A T 9: 18,335,021 probably null Het
Nlrp14 A T 7: 107,182,662 L355F probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcnx4 T C 12: 72,575,398 I1047T probably benign Het
Pcolce2 G A 9: 95,678,405 W169* probably null Het
Plxdc2 A G 2: 16,512,190 D94G probably benign Het
Rp1 A T 1: 4,345,959 Y1643* probably null Het
Skint4 A G 4: 112,118,205 T121A possibly damaging Het
Speg A G 1: 75,430,465 I3133V possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trim34a T A 7: 104,261,055 S355T probably damaging Het
Trpv6 T G 6: 41,626,111 N276H probably damaging Het
Vps8 T C 16: 21,568,413 V1175A probably damaging Het
Other mutations in Ndufa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ndufa8 APN 2 36044455 missense probably damaging 0.99
IGL02603:Ndufa8 APN 2 36044458 missense probably damaging 1.00
R0322:Ndufa8 UTSW 2 36036622 missense probably benign 0.11
R2161:Ndufa8 UTSW 2 36036515 missense probably damaging 1.00
R3001:Ndufa8 UTSW 2 36036559 missense possibly damaging 0.83
R3002:Ndufa8 UTSW 2 36036559 missense possibly damaging 0.83
R6186:Ndufa8 UTSW 2 36039740 missense probably benign 0.16
R7068:Ndufa8 UTSW 2 36044435 missense possibly damaging 0.95
R8536:Ndufa8 UTSW 2 36049300 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGGGAAGTCATCTTTAAAGGC -3'
(R):5'- CAGCAGTCTCAGGGTTACTAC -3'

Sequencing Primer
(F):5'- GGAAGTCATCTTTAAAGGCTAAAAGG -3'
(R):5'- CTCAGGGTTACTACTGTTCAAGAGTC -3'
Posted On2014-10-30