Incidental Mutation 'R2287:Ehf'
ID 244147
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Name ets homologous factor
Synonyms 9030625L19Rik
MMRRC Submission 040286-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.711) question?
Stock # R2287 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 103093776-103133620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103097469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000106807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788]
AlphaFold O70273
Predicted Effect probably benign
Transcript: ENSMUST00000090475
AA Change: I216V

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350
AA Change: I216V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111174
AA Change: I216V

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350
AA Change: I216V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111176
AA Change: I193V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350
AA Change: I193V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125788
AA Change: I227V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350
AA Change: I227V

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137774
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Clec4f CTT CT 6: 83,630,247 (GRCm39) probably null Het
Dis3l T A 9: 64,214,779 (GRCm39) Q930L probably benign Het
Edem2 T C 2: 155,555,279 (GRCm39) K275E probably benign Het
Gsdma3 A G 11: 98,528,830 (GRCm39) N428S possibly damaging Het
Gtf2h4 C A 17: 35,982,117 (GRCm39) probably null Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Naalad2 A T 9: 18,246,317 (GRCm39) probably null Het
Ndufa8 C T 2: 35,926,554 (GRCm39) A161T probably benign Het
Nlrp14 A T 7: 106,781,869 (GRCm39) L355F probably damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Pcnx4 T C 12: 72,622,172 (GRCm39) I1047T probably benign Het
Pcolce2 G A 9: 95,560,458 (GRCm39) W169* probably null Het
Plxdc2 A G 2: 16,517,001 (GRCm39) D94G probably benign Het
Rp1 A T 1: 4,416,182 (GRCm39) Y1643* probably null Het
Skint4 A G 4: 111,975,402 (GRCm39) T121A possibly damaging Het
Speg A G 1: 75,407,109 (GRCm39) I3133V possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trim34a T A 7: 103,910,262 (GRCm39) S355T probably damaging Het
Trpv6 T G 6: 41,603,045 (GRCm39) N276H probably damaging Het
Vps8 T C 16: 21,387,163 (GRCm39) V1175A probably damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103,097,185 (GRCm39) splice site probably null
IGL01296:Ehf APN 2 103,098,500 (GRCm39) splice site probably null
IGL02095:Ehf APN 2 103,097,336 (GRCm39) missense probably damaging 1.00
R0399:Ehf UTSW 2 103,097,215 (GRCm39) missense probably damaging 1.00
R1116:Ehf UTSW 2 103,097,354 (GRCm39) missense probably damaging 1.00
R1728:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R1729:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R2240:Ehf UTSW 2 103,104,420 (GRCm39) missense probably benign
R2397:Ehf UTSW 2 103,107,164 (GRCm39) missense probably damaging 0.99
R4094:Ehf UTSW 2 103,121,095 (GRCm39) intron probably benign
R4687:Ehf UTSW 2 103,097,471 (GRCm39) missense probably damaging 1.00
R4930:Ehf UTSW 2 103,097,202 (GRCm39) missense probably damaging 1.00
R5695:Ehf UTSW 2 103,097,124 (GRCm39) missense probably damaging 1.00
R5925:Ehf UTSW 2 103,097,338 (GRCm39) splice site probably null
R6656:Ehf UTSW 2 103,113,928 (GRCm39) missense probably damaging 1.00
R8217:Ehf UTSW 2 103,109,976 (GRCm39) missense possibly damaging 0.94
R9008:Ehf UTSW 2 103,097,173 (GRCm39) missense
Z1176:Ehf UTSW 2 103,109,863 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AATTAGCTCACCTCATAGCCCG -3'
(R):5'- TAGTAGTCAAACTGTGTGGCAC -3'

Sequencing Primer
(F):5'- CCGGCTGAGCTTCTCGTATG -3'
(R):5'- ACTGTGTGGCACTGGCTAAAC -3'
Posted On 2014-10-30