Mutagenetix > Incidental Mutation

Incidental Mutation 'R2287:Kcnd3'

244149

Institutional Source

Beutler Lab

Gene Symbol

Kcnd3

Ensembl Gene

ENSMUSG00000040896

Gene Name

potassium voltage-gated channel, Shal-related family, member 3

Synonyms

Kv4.3, potassium channel Kv4.3L, potassium channel Kv4.3M

MMRRC Submission

040286-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2287 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105359646-105581318 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105566082 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 421 (A421V)

Ref Sequence

ENSEMBL: ENSMUSP00000113436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]

AlphaFold

Q9Z0V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000079169
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: A421V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098761
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: A421V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	7.3e-19	PFAM
BTB	40	139	1.76e-16	SMART
transmembrane domain	180	202	N/A	INTRINSIC
Pfam:Ion_trans	228	402	1e-31	PFAM
Pfam:Ion_trans_2	327	408	8.4e-15	PFAM
low complexity region	412	431	N/A	INTRINSIC
Pfam:DUF3399	442	545	9.5e-52	PFAM
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118360
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: A421V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141694

Meta Mutation Damage Score

0.1470

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Clec4f	CTT	CT	6: 83,630,247 (GRCm39)		probably null	Het
Dis3l	T	A	9: 64,214,779 (GRCm39)	Q930L	probably benign	Het
Edem2	T	C	2: 155,555,279 (GRCm39)	K275E	probably benign	Het
Ehf	T	C	2: 103,097,469 (GRCm39)	I193V	possibly damaging	Het
Gsdma3	A	G	11: 98,528,830 (GRCm39)	N428S	possibly damaging	Het
Gtf2h4	C	A	17: 35,982,117 (GRCm39)		probably null	Het
Naalad2	A	T	9: 18,246,317 (GRCm39)		probably null	Het
Ndufa8	C	T	2: 35,926,554 (GRCm39)	A161T	probably benign	Het
Nlrp14	A	T	7: 106,781,869 (GRCm39)	L355F	probably damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Pcnx4	T	C	12: 72,622,172 (GRCm39)	I1047T	probably benign	Het
Pcolce2	G	A	9: 95,560,458 (GRCm39)	W169*	probably null	Het
Plxdc2	A	G	2: 16,517,001 (GRCm39)	D94G	probably benign	Het
Rp1	A	T	1: 4,416,182 (GRCm39)	Y1643*	probably null	Het
Skint4	A	G	4: 111,975,402 (GRCm39)	T121A	possibly damaging	Het
Speg	A	G	1: 75,407,109 (GRCm39)	I3133V	possibly damaging	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Trim34a	T	A	7: 103,910,262 (GRCm39)	S355T	probably damaging	Het
Trpv6	T	G	6: 41,603,045 (GRCm39)	N276H	probably damaging	Het
Vps8	T	C	16: 21,387,163 (GRCm39)	V1175A	probably damaging	Het

Other mutations in Kcnd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02296:Kcnd3	APN	3	105,574,317 (GRCm39)	nonsense	probably null
PIT4498001:Kcnd3	UTSW	3	105,566,025 (GRCm39)	missense	probably damaging	0.99
R0483:Kcnd3	UTSW	3	105,366,942 (GRCm39)	missense	probably damaging	1.00
R0544:Kcnd3	UTSW	3	105,566,075 (GRCm39)	missense	probably damaging	1.00
R1457:Kcnd3	UTSW	3	105,575,502 (GRCm39)	missense	probably benign	0.00
R1853:Kcnd3	UTSW	3	105,367,068 (GRCm39)	missense	probably damaging	1.00
R2030:Kcnd3	UTSW	3	105,366,853 (GRCm39)	missense	probably damaging	1.00
R2077:Kcnd3	UTSW	3	105,574,315 (GRCm39)	missense	probably benign	0.16
R2106:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2288:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2316:Kcnd3	UTSW	3	105,576,442 (GRCm39)	missense	probably benign	0.17
R2909:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2924:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2925:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3014:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3016:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3038:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3696:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3697:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3698:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3777:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3778:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3785:Kcnd3	UTSW	3	105,575,541 (GRCm39)	missense	possibly damaging	0.79
R3810:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3811:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3815:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3816:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3819:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3877:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3879:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3899:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4300:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4367:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4370:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4491:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4549:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4550:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4569:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4571:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4593:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4594:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4595:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4624:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4625:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4627:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4630:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4631:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4632:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4799:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4822:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R5021:Kcnd3	UTSW	3	105,566,070 (GRCm39)	missense	probably damaging	1.00
R5056:Kcnd3	UTSW	3	105,574,244 (GRCm39)	intron	probably benign
R5849:Kcnd3	UTSW	3	105,366,111 (GRCm39)	utr 5 prime	probably benign
R7198:Kcnd3	UTSW	3	105,366,856 (GRCm39)	missense	probably damaging	1.00
R7224:Kcnd3	UTSW	3	105,576,400 (GRCm39)	missense	probably damaging	0.98
R7532:Kcnd3	UTSW	3	105,575,526 (GRCm39)	missense	probably damaging	1.00
R7578:Kcnd3	UTSW	3	105,366,933 (GRCm39)	missense	probably benign	0.08
R7975:Kcnd3	UTSW	3	105,366,310 (GRCm39)	missense	probably damaging	1.00
R8022:Kcnd3	UTSW	3	105,366,189 (GRCm39)	missense	probably benign	0.19
R8823:Kcnd3	UTSW	3	105,574,330 (GRCm39)	missense	probably benign	0.00
R8986:Kcnd3	UTSW	3	105,367,039 (GRCm39)	missense	probably damaging	1.00
R9056:Kcnd3	UTSW	3	105,574,290 (GRCm39)	missense	possibly damaging	0.48
R9345:Kcnd3	UTSW	3	105,566,003 (GRCm39)	missense	probably damaging	1.00
R9513:Kcnd3	UTSW	3	105,572,863 (GRCm39)	critical splice donor site	probably null
Z1177:Kcnd3	UTSW	3	105,366,886 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ATGAAGCCCCACTTGTTTCC -3'
(R):5'- TGAGGCTAACTGAGGACATTG -3'

Sequencing Primer
(F):5'- ACTTGTTTCCCACATGGCC -3'
(R):5'- CTAACTGAGGACATTGGTGGG -3'

Posted On

2014-10-30