Incidental Mutation 'R2288:Tmem246'
ID244174
Institutional Source Beutler Lab
Gene Symbol Tmem246
Ensembl Gene ENSMUSG00000039611
Gene Nametransmembrane protein 246
Synonyms
MMRRC Submission 040287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2288 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49584506-49597876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49586445 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 241 (L241Q)
Ref Sequence ENSEMBL: ENSMUSP00000040885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042750] [ENSMUST00000150664] [ENSMUST00000151542]
Predicted Effect probably damaging
Transcript: ENSMUST00000042750
AA Change: L241Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040885
Gene: ENSMUSG00000039611
AA Change: L241Q

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 262 280 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150664
SMART Domains Protein: ENSMUSP00000115100
Gene: ENSMUSG00000039611

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151542
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf4 T C 17: 42,667,511 T314A probably benign Het
Ces2a T C 8: 104,737,437 S234P probably damaging Het
Cfh A T 1: 140,098,901 N571K possibly damaging Het
Clasp1 A G 1: 118,578,878 I940V probably benign Het
Dapk1 T C 13: 60,761,749 L1392S probably damaging Het
Fbxw19 T A 9: 109,493,568 L111F probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nek10 G T 14: 14,853,956 E381* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1033 T A 2: 86,042,033 C239* probably null Het
Peg3 T C 7: 6,709,115 E1036G probably damaging Het
Psma3 T G 12: 70,994,371 D173E possibly damaging Het
Ptpn14 T C 1: 189,865,498 L1135P probably damaging Het
Sfxn1 A G 13: 54,093,957 I234V probably benign Het
Tcf20 A G 15: 82,851,685 V1855A probably benign Het
Tctn3 A T 19: 40,605,713 C419S probably damaging Het
Tlr3 T A 8: 45,397,668 I207F probably damaging Het
Ubr1 T A 2: 120,909,482 R992S probably damaging Het
V1ra8 T C 6: 90,203,042 S76P probably damaging Het
Vnn3 A G 10: 23,864,456 D219G probably benign Het
Zfp536 T A 7: 37,480,348 D944V probably damaging Het
Zfp683 CGGG CCGGGGG 4: 134,056,070 probably benign Het
Other mutations in Tmem246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Tmem246 APN 4 49586860 missense possibly damaging 0.92
IGL02210:Tmem246 APN 4 49586686 missense probably benign
IGL03239:Tmem246 APN 4 49586034 missense probably damaging 0.99
R0344:Tmem246 UTSW 4 49586566 missense probably benign
R1134:Tmem246 UTSW 4 49586832 missense probably benign
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R2247:Tmem246 UTSW 4 49586209 missense probably benign 0.05
R4630:Tmem246 UTSW 4 49586254 missense probably benign 0.40
R5530:Tmem246 UTSW 4 49586226 missense probably benign 0.04
R5939:Tmem246 UTSW 4 49586412 missense probably damaging 0.98
R5955:Tmem246 UTSW 4 49586613 missense probably damaging 1.00
R7009:Tmem246 UTSW 4 49586325 missense probably benign
R7837:Tmem246 UTSW 4 49586262 missense probably damaging 0.96
Z1088:Tmem246 UTSW 4 49587135 missense probably damaging 0.97
Z1177:Tmem246 UTSW 4 49586872 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAATAGTGTCGGCCCACCAG -3'
(R):5'- GTGATGACCCTTCCACTAACTC -3'

Sequencing Primer
(F):5'- GCCCCATGCTGTAGAGAC -3'
(R):5'- CCTTCCACTAACTCATTTGAGAAAG -3'
Posted On2014-10-30