Incidental Mutation 'R2289:2010300C02Rik'
ID244194
Institutional Source Beutler Lab
Gene Symbol 2010300C02Rik
Ensembl Gene ENSMUSG00000026090
Gene NameRIKEN cDNA 2010300C02 gene
Synonyms
MMRRC Submission 040288-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2289 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location37611677-37720085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37612261 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1175 (K1175R)
Ref Sequence ENSEMBL: ENSMUSP00000123803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162875]
Predicted Effect unknown
Transcript: ENSMUST00000160023
AA Change: K651R
SMART Domains Protein: ENSMUSP00000125015
Gene: ENSMUSG00000026090
AA Change: K651R

DomainStartEndE-ValueType
internal_repeat_1 2 65 4.52e-24 PROSPERO
internal_repeat_1 65 128 4.52e-24 PROSPERO
low complexity region 181 194 N/A INTRINSIC
low complexity region 223 237 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
low complexity region 441 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160659
Predicted Effect possibly damaging
Transcript: ENSMUST00000162875
AA Change: K1175R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123803
Gene: ENSMUSG00000026090
AA Change: K1175R

DomainStartEndE-ValueType
low complexity region 13 43 N/A INTRINSIC
Pfam:DUF4592 130 243 1.8e-33 PFAM
low complexity region 347 366 N/A INTRINSIC
internal_repeat_2 387 461 2.31e-5 PROSPERO
internal_repeat_3 404 474 3.67e-5 PROSPERO
internal_repeat_1 411 526 3.02e-34 PROSPERO
internal_repeat_2 485 559 2.31e-5 PROSPERO
internal_repeat_1 537 652 3.02e-34 PROSPERO
internal_repeat_3 570 698 3.67e-5 PROSPERO
low complexity region 705 718 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 965 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp12a G A 14: 56,373,262 V288I possibly damaging Het
Cntn6 C T 6: 104,569,028 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcaf10 T A 4: 45,359,816 W244R probably damaging Het
Dixdc1 A G 9: 50,683,872 probably null Het
Dlg4 T A 11: 70,026,926 Y12N probably damaging Het
Fsd1l T A 4: 53,696,931 Y442N possibly damaging Het
Gm156 T C 6: 129,768,177 N152S probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcrt C A 11: 100,761,919 A90S probably damaging Het
Itga6 T A 2: 71,818,529 V119D probably damaging Het
Lman1l T A 9: 57,613,658 E220V possibly damaging Het
Lmtk2 T A 5: 144,176,106 S1215T possibly damaging Het
Loxl2 G A 14: 69,693,075 E763K probably benign Het
Mcrip1 T C 11: 120,544,704 E35G probably damaging Het
Nle1 T A 11: 82,903,053 I386F probably benign Het
Nqo1 T C 8: 107,392,998 I8V probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pax8 T C 2: 24,440,740 D227G probably benign Het
Phf14 T C 6: 12,047,846 C885R probably damaging Het
Rhobtb3 A C 13: 75,910,927 C251G probably damaging Het
Samd13 C T 3: 146,662,691 A49T probably damaging Het
Snrpa1 T A 7: 66,063,838 V101E probably benign Het
Styx A G 14: 45,354,947 E20G possibly damaging Het
Thoc1 T C 18: 9,984,488 Y325H probably damaging Het
Tmem163 T A 1: 127,495,740 T262S possibly damaging Het
Tsr1 T G 11: 74,899,285 L102R probably damaging Het
Vash1 G C 12: 86,680,178 R64P probably damaging Het
Vps13b A C 15: 35,572,105 D956A probably damaging Het
Vrk1 G A 12: 106,057,861 G199S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp870 A T 17: 32,883,360 S333T probably benign Het
Zranb1 T C 7: 132,950,039 Y140H probably damaging Het
Zscan4b A G 7: 10,901,862 probably null Het
Other mutations in 2010300C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:2010300C02Rik APN 1 37628344 missense probably damaging 0.99
IGL01413:2010300C02Rik APN 1 37612306 missense possibly damaging 0.85
IGL01812:2010300C02Rik APN 1 37625365 missense probably benign 0.06
IGL02183:2010300C02Rik APN 1 37625378 missense possibly damaging 0.93
IGL02498:2010300C02Rik APN 1 37623845 missense probably benign
IGL02713:2010300C02Rik APN 1 37624137 missense possibly damaging 0.72
IGL02736:2010300C02Rik APN 1 37637873 missense probably damaging 1.00
FR4449:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4449:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4548:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
FR4737:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4737:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4976:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0055:2010300C02Rik UTSW 1 37624256 missense probably benign 0.18
R0153:2010300C02Rik UTSW 1 37624639 missense probably benign
R0523:2010300C02Rik UTSW 1 37644629 start codon destroyed probably null 0.94
R0699:2010300C02Rik UTSW 1 37612330 missense possibly damaging 0.85
R0928:2010300C02Rik UTSW 1 37624582 missense possibly damaging 0.85
R1457:2010300C02Rik UTSW 1 37626012 nonsense probably null
R1759:2010300C02Rik UTSW 1 37625710 missense probably benign 0.00
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R2421:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2422:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2509:2010300C02Rik UTSW 1 37625300 missense probably benign
R2510:2010300C02Rik UTSW 1 37625300 missense probably benign
R2511:2010300C02Rik UTSW 1 37625300 missense probably benign
R3893:2010300C02Rik UTSW 1 37631458 missense probably benign 0.00
R4351:2010300C02Rik UTSW 1 37624912 missense probably benign
R4454:2010300C02Rik UTSW 1 37624753 missense probably damaging 1.00
R4788:2010300C02Rik UTSW 1 37631475 missense probably damaging 1.00
R4798:2010300C02Rik UTSW 1 37624965 missense probably benign 0.12
R5599:2010300C02Rik UTSW 1 37613343 missense possibly damaging 0.53
R5920:2010300C02Rik UTSW 1 37637981 missense probably damaging 1.00
R6051:2010300C02Rik UTSW 1 37624225 missense probably damaging 0.98
R6106:2010300C02Rik UTSW 1 37613412 missense possibly damaging 0.53
R6794:2010300C02Rik UTSW 1 37637855 splice site probably null
R6828:2010300C02Rik UTSW 1 37624817 missense possibly damaging 0.53
R6930:2010300C02Rik UTSW 1 37624945 missense possibly damaging 0.73
R7044:2010300C02Rik UTSW 1 37612280 missense possibly damaging 0.85
R7069:2010300C02Rik UTSW 1 37631901 missense probably damaging 1.00
R7149:2010300C02Rik UTSW 1 37612271 nonsense probably null
R7296:2010300C02Rik UTSW 1 37614618 missense possibly damaging 0.53
R7698:2010300C02Rik UTSW 1 37625371 missense probably benign 0.12
R7714:2010300C02Rik UTSW 1 37624777 missense probably benign 0.33
X0025:2010300C02Rik UTSW 1 37624945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AATGGCGCCCCTAAACTTC -3'
(R):5'- GAGGCTTAGCGAAAACCCAC -3'

Sequencing Primer
(F):5'- CACTGAGGCTGTCTGCTG -3'
(R):5'- GCTTAGCGAAAACCCACACTGG -3'
Posted On2014-10-30