Incidental Mutation 'R2289:Fsd1l'
ID244201
Institutional Source Beutler Lab
Gene Symbol Fsd1l
Ensembl Gene ENSMUSG00000054752
Gene Namefibronectin type III and SPRY domain containing 1-like
SynonymsA230072O16Rik, Csdufd1, Fsd1nl, Ccdc10
MMRRC Submission 040288-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R2289 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53631471-53707009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53696931 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 442 (Y442N)
Ref Sequence ENSEMBL: ENSMUSP00000114931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132151] [ENSMUST00000159415] [ENSMUST00000163067] [ENSMUST00000180164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000132151
AA Change: Y442N

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114931
Gene: ENSMUSG00000054752
AA Change: Y442N

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159415
AA Change: Y452N

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124002
Gene: ENSMUSG00000054752
AA Change: Y452N

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 360 480 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163067
AA Change: Y441N

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124613
Gene: ENSMUSG00000054752
AA Change: Y441N

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 349 469 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179534
AA Change: Y452N

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136849
Gene: ENSMUSG00000054752
AA Change: Y452N

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 362 479 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180164
AA Change: Y442N

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136184
Gene: ENSMUSG00000054752
AA Change: Y442N

DomainStartEndE-ValueType
BBC 4 130 1.4e-7 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 1.2e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,612,261 K1175R possibly damaging Het
Atp12a G A 14: 56,373,262 V288I possibly damaging Het
Cntn6 C T 6: 104,569,028 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcaf10 T A 4: 45,359,816 W244R probably damaging Het
Dixdc1 A G 9: 50,683,872 probably null Het
Dlg4 T A 11: 70,026,926 Y12N probably damaging Het
Gm156 T C 6: 129,768,177 N152S probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcrt C A 11: 100,761,919 A90S probably damaging Het
Itga6 T A 2: 71,818,529 V119D probably damaging Het
Lman1l T A 9: 57,613,658 E220V possibly damaging Het
Lmtk2 T A 5: 144,176,106 S1215T possibly damaging Het
Loxl2 G A 14: 69,693,075 E763K probably benign Het
Mcrip1 T C 11: 120,544,704 E35G probably damaging Het
Nle1 T A 11: 82,903,053 I386F probably benign Het
Nqo1 T C 8: 107,392,998 I8V probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pax8 T C 2: 24,440,740 D227G probably benign Het
Phf14 T C 6: 12,047,846 C885R probably damaging Het
Rhobtb3 A C 13: 75,910,927 C251G probably damaging Het
Samd13 C T 3: 146,662,691 A49T probably damaging Het
Snrpa1 T A 7: 66,063,838 V101E probably benign Het
Styx A G 14: 45,354,947 E20G possibly damaging Het
Thoc1 T C 18: 9,984,488 Y325H probably damaging Het
Tmem163 T A 1: 127,495,740 T262S possibly damaging Het
Tsr1 T G 11: 74,899,285 L102R probably damaging Het
Vash1 G C 12: 86,680,178 R64P probably damaging Het
Vps13b A C 15: 35,572,105 D956A probably damaging Het
Vrk1 G A 12: 106,057,861 G199S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp870 A T 17: 32,883,360 S333T probably benign Het
Zranb1 T C 7: 132,950,039 Y140H probably damaging Het
Zscan4b A G 7: 10,901,862 probably null Het
Other mutations in Fsd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fsd1l APN 4 53682187 missense probably damaging 1.00
IGL01019:Fsd1l APN 4 53694742 missense probably damaging 1.00
IGL01154:Fsd1l APN 4 53701074 missense probably benign 0.01
IGL01359:Fsd1l APN 4 53659601 missense possibly damaging 0.78
IGL01996:Fsd1l APN 4 53647760 missense probably benign 0.00
IGL02192:Fsd1l APN 4 53647754 missense probably benign
IGL02629:Fsd1l APN 4 53686417 missense probably damaging 1.00
R0009:Fsd1l UTSW 4 53687209 missense probably benign 0.01
R0166:Fsd1l UTSW 4 53647664 splice site probably null
R0255:Fsd1l UTSW 4 53694727 missense probably damaging 1.00
R0349:Fsd1l UTSW 4 53679854 missense probably damaging 0.97
R0409:Fsd1l UTSW 4 53679932 missense probably benign 0.00
R1886:Fsd1l UTSW 4 53696984 splice site probably null
R1887:Fsd1l UTSW 4 53696984 splice site probably null
R2039:Fsd1l UTSW 4 53679972 missense probably benign 0.02
R4577:Fsd1l UTSW 4 53686397 missense probably damaging 1.00
R5134:Fsd1l UTSW 4 53647766 missense probably benign 0.43
R6073:Fsd1l UTSW 4 53679994 missense probably damaging 1.00
R6216:Fsd1l UTSW 4 53694742 missense probably damaging 1.00
R7184:Fsd1l UTSW 4 53694054 missense probably damaging 1.00
R7285:Fsd1l UTSW 4 53682200 critical splice donor site probably null
R7423:Fsd1l UTSW 4 53686406 missense probably damaging 1.00
R7465:Fsd1l UTSW 4 53647755 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATATTAGTAAGGTTTTGATGACCAGG -3'
(R):5'- ATATCACGTCTGGAAAGGGC -3'

Sequencing Primer
(F):5'- CAGATTTCTGAGTTCAAGGCCAGC -3'
(R):5'- TCTGGAAAGGGCAGGCTG -3'
Posted On2014-10-30