Incidental Mutation 'R2289:Zscan4b'
ID244209
Institutional Source Beutler Lab
Gene Symbol Zscan4b
Ensembl Gene ENSMUSG00000095339
Gene Namezinc finger and SCAN domain containing 4B
SynonymsEG665780
MMRRC Submission 040288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2289 (G1)
Quality Score164
Status Not validated
Chromosome7
Chromosomal Location10900740-10905050 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 10901862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168158] [ENSMUST00000168158] [ENSMUST00000210847] [ENSMUST00000210847]
Predicted Effect probably null
Transcript: ENSMUST00000168158
SMART Domains Protein: ENSMUSP00000127301
Gene: ENSMUSG00000095339

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.8e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168158
SMART Domains Protein: ENSMUSP00000127301
Gene: ENSMUSG00000095339

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.8e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210847
Predicted Effect probably null
Transcript: ENSMUST00000210847
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,612,261 K1175R possibly damaging Het
Atp12a G A 14: 56,373,262 V288I possibly damaging Het
Cntn6 C T 6: 104,569,028 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcaf10 T A 4: 45,359,816 W244R probably damaging Het
Dixdc1 A G 9: 50,683,872 probably null Het
Dlg4 T A 11: 70,026,926 Y12N probably damaging Het
Fsd1l T A 4: 53,696,931 Y442N possibly damaging Het
Gm156 T C 6: 129,768,177 N152S probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcrt C A 11: 100,761,919 A90S probably damaging Het
Itga6 T A 2: 71,818,529 V119D probably damaging Het
Lman1l T A 9: 57,613,658 E220V possibly damaging Het
Lmtk2 T A 5: 144,176,106 S1215T possibly damaging Het
Loxl2 G A 14: 69,693,075 E763K probably benign Het
Mcrip1 T C 11: 120,544,704 E35G probably damaging Het
Nle1 T A 11: 82,903,053 I386F probably benign Het
Nqo1 T C 8: 107,392,998 I8V probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pax8 T C 2: 24,440,740 D227G probably benign Het
Phf14 T C 6: 12,047,846 C885R probably damaging Het
Rhobtb3 A C 13: 75,910,927 C251G probably damaging Het
Samd13 C T 3: 146,662,691 A49T probably damaging Het
Snrpa1 T A 7: 66,063,838 V101E probably benign Het
Styx A G 14: 45,354,947 E20G possibly damaging Het
Thoc1 T C 18: 9,984,488 Y325H probably damaging Het
Tmem163 T A 1: 127,495,740 T262S possibly damaging Het
Tsr1 T G 11: 74,899,285 L102R probably damaging Het
Vash1 G C 12: 86,680,178 R64P probably damaging Het
Vps13b A C 15: 35,572,105 D956A probably damaging Het
Vrk1 G A 12: 106,057,861 G199S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp870 A T 17: 32,883,360 S333T probably benign Het
Zranb1 T C 7: 132,950,039 Y140H probably damaging Het
Other mutations in Zscan4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4696001:Zscan4b UTSW 7 10902022 missense possibly damaging 0.77
R0628:Zscan4b UTSW 7 10901463 missense probably damaging 0.99
R3713:Zscan4b UTSW 7 10901891 missense probably benign 0.01
R6129:Zscan4b UTSW 7 10901888 missense probably benign 0.01
R6393:Zscan4b UTSW 7 10900901 missense possibly damaging 0.76
R7057:Zscan4b UTSW 7 10901709 nonsense probably null
R7312:Zscan4b UTSW 7 10900940 missense probably benign 0.00
R7383:Zscan4b UTSW 7 10904033 missense possibly damaging 0.92
R7412:Zscan4b UTSW 7 10900864 missense probably damaging 1.00
R7412:Zscan4b UTSW 7 10901893 missense probably benign 0.03
R7449:Zscan4b UTSW 7 10904058 missense possibly damaging 0.95
Z1177:Zscan4b UTSW 7 10901737 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCTGGGTAATAAGAAGGGAGTCC -3'
(R):5'- GTGTCTGCAATCCACATGCTC -3'

Sequencing Primer
(F):5'- GGGAGTCCTTTTCATTTCCACTACAG -3'
(R):5'- GAAGGACATGTCTTCCCTTACAGG -3'
Posted On2014-10-30