Incidental Mutation 'R2289:Nsf'
ID244224
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene NameN-ethylmaleimide sensitive fusion protein
SynonymsSKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 040288-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2289 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103821782-103954056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103930752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,612,261 K1175R possibly damaging Het
Atp12a G A 14: 56,373,262 V288I possibly damaging Het
Cntn6 C T 6: 104,569,028 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcaf10 T A 4: 45,359,816 W244R probably damaging Het
Dixdc1 A G 9: 50,683,872 probably null Het
Dlg4 T A 11: 70,026,926 Y12N probably damaging Het
Fsd1l T A 4: 53,696,931 Y442N possibly damaging Het
Gm156 T C 6: 129,768,177 N152S probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcrt C A 11: 100,761,919 A90S probably damaging Het
Itga6 T A 2: 71,818,529 V119D probably damaging Het
Lman1l T A 9: 57,613,658 E220V possibly damaging Het
Lmtk2 T A 5: 144,176,106 S1215T possibly damaging Het
Loxl2 G A 14: 69,693,075 E763K probably benign Het
Mcrip1 T C 11: 120,544,704 E35G probably damaging Het
Nle1 T A 11: 82,903,053 I386F probably benign Het
Nqo1 T C 8: 107,392,998 I8V probably benign Het
Pax8 T C 2: 24,440,740 D227G probably benign Het
Phf14 T C 6: 12,047,846 C885R probably damaging Het
Rhobtb3 A C 13: 75,910,927 C251G probably damaging Het
Samd13 C T 3: 146,662,691 A49T probably damaging Het
Snrpa1 T A 7: 66,063,838 V101E probably benign Het
Styx A G 14: 45,354,947 E20G possibly damaging Het
Thoc1 T C 18: 9,984,488 Y325H probably damaging Het
Tmem163 T A 1: 127,495,740 T262S possibly damaging Het
Tsr1 T G 11: 74,899,285 L102R probably damaging Het
Vash1 G C 12: 86,680,178 R64P probably damaging Het
Vps13b A C 15: 35,572,105 D956A probably damaging Het
Vrk1 G A 12: 106,057,861 G199S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp870 A T 17: 32,883,360 S333T probably benign Het
Zranb1 T C 7: 132,950,039 Y140H probably damaging Het
Zscan4b A G 7: 10,901,862 probably null Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
R7769:Nsf UTSW 11 103928839 missense probably damaging 1.00
X0066:Nsf UTSW 11 103823740 missense probably benign
Z1176:Nsf UTSW 11 103910554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCAAGGTGACTACCAACC -3'
(R):5'- ATGCAGTTGTGTGGTAAGGAAGG -3'

Sequencing Primer
(F):5'- TGTGATACCTATACCCAGTG -3'
(R):5'- AGGGTGCTTTCTTCTAGTGC -3'
Posted On2014-10-30