Incidental Mutation 'R2289:Rhobtb3'
ID244228
Institutional Source Beutler Lab
Gene Symbol Rhobtb3
Ensembl Gene ENSMUSG00000021589
Gene NameRho-related BTB domain containing 3
Synonyms2610033K01Rik, 4930503C18Rik, 1700040C17Rik
MMRRC Submission 040288-MU
Accession Numbers

Ncbi RefSeq: NM_028493.2; MGI:1920546

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R2289 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location75869537-75943925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 75910927 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 251 (C251G)
Ref Sequence ENSEMBL: ENSMUSP00000022078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022078] [ENSMUST00000109606]
Predicted Effect probably damaging
Transcript: ENSMUST00000022078
AA Change: C251G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022078
Gene: ENSMUSG00000021589
AA Change: C251G

DomainStartEndE-ValueType
Pfam:Ras 47 195 9e-7 PFAM
Blast:BTB 254 406 2e-95 BLAST
BTB 420 518 3.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109606
SMART Domains Protein: ENSMUSP00000105235
Gene: ENSMUSG00000021589

DomainStartEndE-ValueType
Pfam:Ras 45 195 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220939
AA Change: C59G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RHOBTB3 is a member of the evolutionarily conserved RHOBTB subfamily of Rho GTPases. For background information on RHOBTBs, see RHOBTB1 (MIM 607351).[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality, reduced body weight and slightly reduced organ weights that varies by sex. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,612,261 K1175R possibly damaging Het
Atp12a G A 14: 56,373,262 V288I possibly damaging Het
Cntn6 C T 6: 104,569,028 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcaf10 T A 4: 45,359,816 W244R probably damaging Het
Dixdc1 A G 9: 50,683,872 probably null Het
Dlg4 T A 11: 70,026,926 Y12N probably damaging Het
Fsd1l T A 4: 53,696,931 Y442N possibly damaging Het
Gm156 T C 6: 129,768,177 N152S probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcrt C A 11: 100,761,919 A90S probably damaging Het
Itga6 T A 2: 71,818,529 V119D probably damaging Het
Lman1l T A 9: 57,613,658 E220V possibly damaging Het
Lmtk2 T A 5: 144,176,106 S1215T possibly damaging Het
Loxl2 G A 14: 69,693,075 E763K probably benign Het
Mcrip1 T C 11: 120,544,704 E35G probably damaging Het
Nle1 T A 11: 82,903,053 I386F probably benign Het
Nqo1 T C 8: 107,392,998 I8V probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pax8 T C 2: 24,440,740 D227G probably benign Het
Phf14 T C 6: 12,047,846 C885R probably damaging Het
Samd13 C T 3: 146,662,691 A49T probably damaging Het
Snrpa1 T A 7: 66,063,838 V101E probably benign Het
Styx A G 14: 45,354,947 E20G possibly damaging Het
Thoc1 T C 18: 9,984,488 Y325H probably damaging Het
Tmem163 T A 1: 127,495,740 T262S possibly damaging Het
Tsr1 T G 11: 74,899,285 L102R probably damaging Het
Vash1 G C 12: 86,680,178 R64P probably damaging Het
Vps13b A C 15: 35,572,105 D956A probably damaging Het
Vrk1 G A 12: 106,057,861 G199S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp870 A T 17: 32,883,360 S333T probably benign Het
Zranb1 T C 7: 132,950,039 Y140H probably damaging Het
Zscan4b A G 7: 10,901,862 probably null Het
Other mutations in Rhobtb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rhobtb3 APN 13 75877428 missense probably damaging 1.00
IGL02142:Rhobtb3 APN 13 75877495 missense probably damaging 1.00
IGL02708:Rhobtb3 APN 13 75917724 missense probably damaging 0.99
IGL02732:Rhobtb3 APN 13 75910937 missense probably damaging 1.00
IGL02969:Rhobtb3 APN 13 75943431 missense probably damaging 1.00
R0048:Rhobtb3 UTSW 13 75902245 makesense probably null
R0285:Rhobtb3 UTSW 13 75877509 missense possibly damaging 0.86
R2233:Rhobtb3 UTSW 13 75872365 missense possibly damaging 0.76
R2332:Rhobtb3 UTSW 13 75910852 missense probably benign 0.44
R3684:Rhobtb3 UTSW 13 75939481 missense probably damaging 1.00
R4685:Rhobtb3 UTSW 13 75878932 nonsense probably null
R5060:Rhobtb3 UTSW 13 75913270 missense probably benign
R5374:Rhobtb3 UTSW 13 75878895 missense probably damaging 0.98
R5688:Rhobtb3 UTSW 13 75872418 missense probably benign 0.01
R6181:Rhobtb3 UTSW 13 75910689 missense probably benign 0.05
R6235:Rhobtb3 UTSW 13 75892910 missense probably damaging 0.99
R6947:Rhobtb3 UTSW 13 75910666 missense probably benign 0.14
R7032:Rhobtb3 UTSW 13 75872394 missense probably benign 0.01
R7039:Rhobtb3 UTSW 13 75872453 nonsense probably null
R7148:Rhobtb3 UTSW 13 75910887 missense probably benign
R7449:Rhobtb3 UTSW 13 75910741 missense probably benign 0.14
R7508:Rhobtb3 UTSW 13 75878857 missense probably benign 0.00
R7598:Rhobtb3 UTSW 13 75910902 missense probably benign 0.00
R7691:Rhobtb3 UTSW 13 75878937 missense probably damaging 0.99
R7770:Rhobtb3 UTSW 13 75917815 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGATCCTGGGTGGTTCG -3'
(R):5'- GCTTCAGTTATCCCTGATGAACTAG -3'

Sequencing Primer
(F):5'- CGGATGATACTGGAATCCTGAATGTC -3'
(R):5'- CTGTCTTGAAAGCTGAGG -3'
Posted On2014-10-30