Incidental Mutation 'R2290:Ptprc'
ID244240
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission 040289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R2290 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138111188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 364 (V364I)
Ref Sequence ENSEMBL: ENSMUSP00000138350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000195533]
Predicted Effect probably benign
Transcript: ENSMUST00000027645
AA Change: V362I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027645
Gene: ENSMUSG00000026395
AA Change: V362I

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5e-16 PFAM
low complexity region 109 126 N/A INTRINSIC
low complexity region 168 203 N/A INTRINSIC
Pfam:CD45 210 267 3.1e-20 PFAM
FN3 372 456 2.28e0 SMART
FN3 472 550 3.48e-1 SMART
transmembrane domain 565 586 N/A INTRINSIC
PTPc 639 901 7.57e-127 SMART
PTPc 930 1216 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182283
AA Change: V225I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: V225I

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182755
AA Change: V201I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: V201I

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183301
AA Change: V364I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: V364I

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188596
Predicted Effect probably benign
Transcript: ENSMUST00000195533
SMART Domains Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 7.4e-11 PFAM
low complexity region 68 115 N/A INTRINSIC
Pfam:CD45 121 180 2.1e-22 PFAM
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,527,313 D62G probably damaging Het
Ambp T C 4: 63,143,687 Y335C probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Asb13 G A 13: 3,649,418 G206D probably damaging Het
Ccdc7b A G 8: 129,131,106 probably benign Het
Cdh15 A T 8: 122,859,317 N145I probably damaging Het
Celsr3 T C 9: 108,843,224 I2565T probably damaging Het
Cfap43 A T 19: 47,773,135 M840K probably damaging Het
Clip4 T C 17: 71,810,953 V331A possibly damaging Het
Cnnm1 A G 19: 43,491,502 T829A probably benign Het
Col24a1 G A 3: 145,513,195 G1457E probably damaging Het
D6Ertd527e A G 6: 87,111,545 N230S unknown Het
Dll1 T C 17: 15,374,748 D89G probably benign Het
Dst T A 1: 34,229,200 V2901E probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Efl1 A T 7: 82,777,670 K1125N probably damaging Het
Efr3a T A 15: 65,849,839 F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,926,942 probably benign Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Gm38999 A G 7: 43,427,699 E5G probably benign Het
Gm5828 C T 1: 16,768,344 noncoding transcript Het
Gnas T C 2: 174,300,010 F717L probably benign Het
H6pd T A 4: 149,981,881 S683C probably damaging Het
Il23r G A 6: 67,423,861 T495I probably benign Het
Itpr2 T C 6: 146,422,828 N135D probably damaging Het
Kcns2 T A 15: 34,838,509 L6Q possibly damaging Het
Khdrbs3 C T 15: 69,029,761 R132C probably damaging Het
Kif2b A G 11: 91,575,696 V587A probably benign Het
Kng1 A T 16: 23,079,125 H425L possibly damaging Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc8e T C 8: 4,231,770 M35T probably damaging Het
Med12l A G 3: 59,244,938 N1048S probably damaging Het
Mex3c A C 18: 73,590,693 N619T probably damaging Het
Mfsd4b1 G A 10: 40,003,331 T190I probably damaging Het
Ncam1 A G 9: 49,523,651 probably benign Het
Nlrp6 G A 7: 140,922,163 G133S probably damaging Het
Olfr1385 A G 11: 49,495,030 M166V probably benign Het
Olfr385 G T 11: 73,588,919 A273D probably benign Het
Olfr957 A G 9: 39,511,678 L14P possibly damaging Het
Olfr994 C T 2: 85,430,200 V210M possibly damaging Het
Oplah A G 15: 76,302,725 V630A probably benign Het
Papd5 T C 8: 88,251,975 S435P probably damaging Het
Pcnx2 A T 8: 125,877,595 probably benign Het
Pkhd1l1 A T 15: 44,528,250 T1571S probably benign Het
Pramef12 T A 4: 144,394,699 T252S probably benign Het
Pramef12 G T 4: 144,395,122 H111N probably benign Het
Prr22 T G 17: 56,771,884 F346V probably benign Het
Prr30 T C 14: 101,198,775 N117S possibly damaging Het
Ptgfrn A G 3: 101,077,361 S172P possibly damaging Het
Ptprz1 T C 6: 23,000,991 S1027P probably damaging Het
Rinl T C 7: 28,792,271 V83A probably benign Het
Ros1 A T 10: 52,118,381 S1268T probably damaging Het
Scly T C 1: 91,298,450 probably null Het
Slc25a1 C T 16: 17,925,848 V186M possibly damaging Het
Stk36 T G 1: 74,626,144 probably benign Het
Syn2 A G 6: 115,274,229 T449A possibly damaging Het
Tecpr1 T C 5: 144,214,063 D309G probably damaging Het
Tns2 T A 15: 102,112,023 Y775N probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ttl G A 2: 129,081,270 G177D possibly damaging Het
Twf1 A G 15: 94,586,519 S41P probably damaging Het
Unc79 C T 12: 103,146,366 T2174M probably damaging Het
Vangl2 T A 1: 172,008,546 K340* probably null Het
Vmn2r72 T A 7: 85,738,341 T672S probably damaging Het
Vwa7 A G 17: 35,017,211 D47G probably damaging Het
Zc3h12d A G 10: 7,867,459 H331R probably benign Het
Zfa-ps T C 10: 52,545,016 noncoding transcript Het
Zfp141 A T 7: 42,475,225 C608S probably damaging Het
Zfp422 A G 6: 116,626,642 I132T possibly damaging Het
Zfp652 A G 11: 95,750,023 Y258C possibly damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Chor_muang UTSW 1 138113562 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGGCAGACACAATTTGAAC -3'
(R):5'- AAGAAGCCCATTTACTATGTGGC -3'

Sequencing Primer
(F):5'- GGCAGACACAATTTGAACAACAG -3'
(R):5'- GAAGCCCATTTACTATGTGGCATTTC -3'
Posted On2014-10-30