Incidental Mutation 'R2290:Med12l'
ID 244245
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Name mediator complex subunit 12-like
Synonyms
MMRRC Submission 040289-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.257) question?
Stock # R2290 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 58913246-59226103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59152359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1048 (N1048S)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
AlphaFold Q8BQM9
Predicted Effect possibly damaging
Transcript: ENSMUST00000040325
AA Change: N1013S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: N1013S

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164225
AA Change: N1048S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: N1048S

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199659
AA Change: N1048S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: N1048S

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.3047 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,363,177 (GRCm39) D62G probably damaging Het
Ambp T C 4: 63,061,924 (GRCm39) Y335C probably damaging Het
Arid4a G T 12: 71,108,315 (GRCm39) G40V probably damaging Het
Asb13 G A 13: 3,699,418 (GRCm39) G206D probably damaging Het
Ccdc7b A G 8: 129,857,587 (GRCm39) probably benign Het
Cdh15 A T 8: 123,586,056 (GRCm39) N145I probably damaging Het
Celsr3 T C 9: 108,720,423 (GRCm39) I2565T probably damaging Het
Cfap43 A T 19: 47,761,574 (GRCm39) M840K probably damaging Het
Clip4 T C 17: 72,117,948 (GRCm39) V331A possibly damaging Het
Cnnm1 A G 19: 43,479,941 (GRCm39) T829A probably benign Het
Col24a1 G A 3: 145,218,950 (GRCm39) G1457E probably damaging Het
D6Ertd527e A G 6: 87,088,527 (GRCm39) N230S unknown Het
Dll1 T C 17: 15,595,010 (GRCm39) D89G probably benign Het
Dst T A 1: 34,268,281 (GRCm39) V2901E probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Efl1 A T 7: 82,426,878 (GRCm39) K1125N probably damaging Het
Efr3a T A 15: 65,721,688 (GRCm39) F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,815,179 (GRCm39) probably benign Het
Ermp1 T C 19: 29,601,178 (GRCm39) D523G probably damaging Het
Gm38999 A G 7: 43,077,123 (GRCm39) E5G probably benign Het
Gm5828 C T 1: 16,838,568 (GRCm39) noncoding transcript Het
Gnas T C 2: 174,141,803 (GRCm39) F717L probably benign Het
H6pd T A 4: 150,066,338 (GRCm39) S683C probably damaging Het
Il23r G A 6: 67,400,845 (GRCm39) T495I probably benign Het
Itpr2 T C 6: 146,324,326 (GRCm39) N135D probably damaging Het
Kcns2 T A 15: 34,838,655 (GRCm39) L6Q possibly damaging Het
Khdrbs3 C T 15: 68,901,610 (GRCm39) R132C probably damaging Het
Kif2b A G 11: 91,466,522 (GRCm39) V587A probably benign Het
Kng1 A T 16: 22,897,875 (GRCm39) H425L possibly damaging Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lrrc8e T C 8: 4,281,770 (GRCm39) M35T probably damaging Het
Mex3c A C 18: 73,723,764 (GRCm39) N619T probably damaging Het
Mfsd4b1 G A 10: 39,879,327 (GRCm39) T190I probably damaging Het
Ncam1 A G 9: 49,434,951 (GRCm39) probably benign Het
Nlrp6 G A 7: 140,502,076 (GRCm39) G133S probably damaging Het
Oplah A G 15: 76,186,925 (GRCm39) V630A probably benign Het
Or1e26 G T 11: 73,479,745 (GRCm39) A273D probably benign Het
Or2y1 A G 11: 49,385,857 (GRCm39) M166V probably benign Het
Or5ak24 C T 2: 85,260,544 (GRCm39) V210M possibly damaging Het
Or8g36 A G 9: 39,422,974 (GRCm39) L14P possibly damaging Het
Pcnx2 A T 8: 126,604,334 (GRCm39) probably benign Het
Pkhd1l1 A T 15: 44,391,646 (GRCm39) T1571S probably benign Het
Pramel13 T A 4: 144,121,269 (GRCm39) T252S probably benign Het
Pramel13 G T 4: 144,121,692 (GRCm39) H111N probably benign Het
Prr22 T G 17: 57,078,884 (GRCm39) F346V probably benign Het
Prr30 T C 14: 101,436,211 (GRCm39) N117S possibly damaging Het
Ptgfrn A G 3: 100,984,677 (GRCm39) S172P possibly damaging Het
Ptprc C T 1: 138,038,926 (GRCm39) V364I probably benign Het
Ptprz1 T C 6: 23,000,990 (GRCm39) S1027P probably damaging Het
Rinl T C 7: 28,491,696 (GRCm39) V83A probably benign Het
Ros1 A T 10: 51,994,477 (GRCm39) S1268T probably damaging Het
Scly T C 1: 91,226,172 (GRCm39) probably null Het
Slc25a1 C T 16: 17,743,712 (GRCm39) V186M possibly damaging Het
Stk36 T G 1: 74,665,303 (GRCm39) probably benign Het
Syn2 A G 6: 115,251,190 (GRCm39) T449A possibly damaging Het
Tecpr1 T C 5: 144,150,881 (GRCm39) D309G probably damaging Het
Tent4b T C 8: 88,978,603 (GRCm39) S435P probably damaging Het
Tns2 T A 15: 102,020,458 (GRCm39) Y775N probably damaging Het
Tril G T 6: 53,795,012 (GRCm39) R737S probably damaging Het
Ttl G A 2: 128,923,190 (GRCm39) G177D possibly damaging Het
Twf1 A G 15: 94,484,400 (GRCm39) S41P probably damaging Het
Unc79 C T 12: 103,112,625 (GRCm39) T2174M probably damaging Het
Vangl2 T A 1: 171,836,113 (GRCm39) K340* probably null Het
Vmn2r72 T A 7: 85,387,549 (GRCm39) T672S probably damaging Het
Vwa7 A G 17: 35,236,187 (GRCm39) D47G probably damaging Het
Zc3h12d A G 10: 7,743,223 (GRCm39) H331R probably benign Het
Zfa-ps T C 10: 52,421,112 (GRCm39) noncoding transcript Het
Zfp141 A T 7: 42,124,649 (GRCm39) C608S probably damaging Het
Zfp422 A G 6: 116,603,603 (GRCm39) I132T possibly damaging Het
Zfp652 A G 11: 95,640,849 (GRCm39) Y258C possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 58,949,757 (GRCm39) missense probably damaging 0.98
IGL00561:Med12l APN 3 59,135,245 (GRCm39) missense probably benign
IGL00974:Med12l APN 3 58,990,435 (GRCm39) missense probably damaging 1.00
IGL01024:Med12l APN 3 58,980,762 (GRCm39) missense probably damaging 1.00
IGL01094:Med12l APN 3 59,001,076 (GRCm39) missense probably damaging 0.99
IGL01134:Med12l APN 3 58,949,696 (GRCm39) missense possibly damaging 0.91
IGL01535:Med12l APN 3 59,169,680 (GRCm39) missense probably damaging 1.00
IGL01653:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL01735:Med12l APN 3 59,170,675 (GRCm39) missense probably damaging 1.00
IGL01972:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL02005:Med12l APN 3 59,152,368 (GRCm39) missense probably damaging 1.00
IGL02098:Med12l APN 3 59,183,276 (GRCm39) missense possibly damaging 0.92
IGL02115:Med12l APN 3 58,975,740 (GRCm39) missense probably benign 0.00
IGL02231:Med12l APN 3 59,153,303 (GRCm39) missense probably damaging 1.00
IGL02259:Med12l APN 3 59,153,264 (GRCm39) missense probably damaging 1.00
IGL02369:Med12l APN 3 59,164,794 (GRCm39) missense probably benign 0.00
IGL02424:Med12l APN 3 59,000,143 (GRCm39) missense probably benign 0.21
IGL02501:Med12l APN 3 59,169,397 (GRCm39) missense possibly damaging 0.71
IGL02525:Med12l APN 3 58,975,789 (GRCm39) missense probably benign 0.01
IGL02530:Med12l APN 3 58,984,510 (GRCm39) missense probably damaging 1.00
IGL02735:Med12l APN 3 59,001,067 (GRCm39) missense probably damaging 1.00
IGL02865:Med12l APN 3 59,201,713 (GRCm39) missense probably damaging 1.00
IGL03183:Med12l APN 3 58,944,976 (GRCm39) splice site probably null
IGL03264:Med12l APN 3 59,208,788 (GRCm39) nonsense probably null
FR4304:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4340:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,415 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,409 (GRCm39) small insertion probably benign
FR4449:Med12l UTSW 3 59,183,384 (GRCm39) nonsense probably null
FR4548:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4589:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
FR4976:Med12l UTSW 3 59,183,398 (GRCm39) small insertion probably benign
P0007:Med12l UTSW 3 58,998,816 (GRCm39) splice site probably benign
P0045:Med12l UTSW 3 58,998,956 (GRCm39) missense probably damaging 0.99
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0148:Med12l UTSW 3 58,945,075 (GRCm39) missense probably damaging 1.00
R0325:Med12l UTSW 3 58,984,480 (GRCm39) missense possibly damaging 0.88
R0330:Med12l UTSW 3 59,135,123 (GRCm39) missense probably damaging 1.00
R0388:Med12l UTSW 3 59,000,925 (GRCm39) splice site probably benign
R0542:Med12l UTSW 3 58,949,822 (GRCm39) missense probably damaging 1.00
R0624:Med12l UTSW 3 58,945,123 (GRCm39) nonsense probably null
R0625:Med12l UTSW 3 59,154,858 (GRCm39) missense probably damaging 1.00
R0671:Med12l UTSW 3 59,172,350 (GRCm39) missense probably damaging 1.00
R0706:Med12l UTSW 3 59,169,401 (GRCm39) missense probably damaging 1.00
R0785:Med12l UTSW 3 59,168,253 (GRCm39) missense probably damaging 1.00
R1054:Med12l UTSW 3 59,156,072 (GRCm39) missense probably damaging 0.99
R1102:Med12l UTSW 3 59,152,257 (GRCm39) missense probably damaging 0.99
R1391:Med12l UTSW 3 58,945,159 (GRCm39) missense probably benign 0.00
R1501:Med12l UTSW 3 59,168,256 (GRCm39) critical splice donor site probably null
R1544:Med12l UTSW 3 59,172,661 (GRCm39) missense possibly damaging 0.71
R1662:Med12l UTSW 3 59,001,038 (GRCm39) missense probably damaging 1.00
R1670:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
R1839:Med12l UTSW 3 58,975,740 (GRCm39) missense probably benign
R1854:Med12l UTSW 3 59,168,193 (GRCm39) missense probably damaging 1.00
R2045:Med12l UTSW 3 59,169,731 (GRCm39) nonsense probably null
R2070:Med12l UTSW 3 59,152,326 (GRCm39) missense probably damaging 1.00
R2132:Med12l UTSW 3 59,172,703 (GRCm39) splice site probably null
R2325:Med12l UTSW 3 59,139,875 (GRCm39) missense probably damaging 0.99
R2352:Med12l UTSW 3 59,148,113 (GRCm39) missense probably damaging 1.00
R2484:Med12l UTSW 3 59,205,259 (GRCm39) missense probably benign 0.18
R2906:Med12l UTSW 3 59,164,503 (GRCm39) missense probably damaging 1.00
R3735:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3736:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3774:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R3957:Med12l UTSW 3 58,980,589 (GRCm39) missense probably damaging 0.99
R4020:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R4087:Med12l UTSW 3 59,205,342 (GRCm39) missense probably benign 0.00
R4231:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4233:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4235:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4236:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4327:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4328:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4346:Med12l UTSW 3 58,938,976 (GRCm39) missense probably damaging 1.00
R4543:Med12l UTSW 3 58,998,929 (GRCm39) missense probably damaging 1.00
R4559:Med12l UTSW 3 58,914,523 (GRCm39) critical splice donor site probably null
R4776:Med12l UTSW 3 59,140,633 (GRCm39) missense probably damaging 1.00
R4877:Med12l UTSW 3 59,152,214 (GRCm39) missense probably damaging 1.00
R4983:Med12l UTSW 3 59,169,350 (GRCm39) missense probably damaging 1.00
R5114:Med12l UTSW 3 59,167,109 (GRCm39) missense possibly damaging 0.85
R5125:Med12l UTSW 3 59,174,635 (GRCm39) missense possibly damaging 0.83
R5230:Med12l UTSW 3 59,153,209 (GRCm39) missense probably damaging 1.00
R5407:Med12l UTSW 3 59,165,622 (GRCm39) missense probably damaging 1.00
R5426:Med12l UTSW 3 59,156,143 (GRCm39) missense probably damaging 0.98
R5439:Med12l UTSW 3 59,170,634 (GRCm39) missense probably null 1.00
R5449:Med12l UTSW 3 59,167,127 (GRCm39) missense probably damaging 1.00
R5596:Med12l UTSW 3 59,159,771 (GRCm39) missense probably benign 0.45
R5716:Med12l UTSW 3 59,208,798 (GRCm39) critical splice donor site probably null
R5833:Med12l UTSW 3 59,172,647 (GRCm39) missense possibly damaging 0.95
R5883:Med12l UTSW 3 58,998,889 (GRCm39) missense probably damaging 1.00
R6264:Med12l UTSW 3 59,163,423 (GRCm39) missense probably damaging 1.00
R6269:Med12l UTSW 3 59,135,243 (GRCm39) missense probably damaging 1.00
R6394:Med12l UTSW 3 59,142,508 (GRCm39) missense probably damaging 1.00
R6400:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R6475:Med12l UTSW 3 59,164,500 (GRCm39) missense probably damaging 1.00
R6489:Med12l UTSW 3 59,164,828 (GRCm39) missense probably damaging 0.99
R6654:Med12l UTSW 3 59,169,713 (GRCm39) missense probably damaging 1.00
R6881:Med12l UTSW 3 59,174,586 (GRCm39) missense probably benign 0.00
R7110:Med12l UTSW 3 59,169,645 (GRCm39) missense possibly damaging 0.92
R7134:Med12l UTSW 3 59,001,180 (GRCm39) nonsense probably null
R7137:Med12l UTSW 3 59,165,675 (GRCm39) missense probably damaging 1.00
R7159:Med12l UTSW 3 59,183,438 (GRCm39) missense probably benign
R7341:Med12l UTSW 3 58,949,824 (GRCm39) missense possibly damaging 0.53
R7349:Med12l UTSW 3 59,165,746 (GRCm39) missense probably damaging 1.00
R7413:Med12l UTSW 3 58,998,971 (GRCm39) missense probably benign 0.00
R7495:Med12l UTSW 3 59,152,194 (GRCm39) missense probably damaging 1.00
R7678:Med12l UTSW 3 58,984,141 (GRCm39) missense probably damaging 1.00
R7697:Med12l UTSW 3 59,148,078 (GRCm39) missense probably damaging 1.00
R7714:Med12l UTSW 3 59,001,007 (GRCm39) missense probably benign 0.17
R7725:Med12l UTSW 3 59,163,413 (GRCm39) missense probably damaging 1.00
R7846:Med12l UTSW 3 59,172,355 (GRCm39) missense probably damaging 1.00
R7852:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R8080:Med12l UTSW 3 59,172,607 (GRCm39) missense probably damaging 1.00
R8181:Med12l UTSW 3 59,169,389 (GRCm39) missense probably damaging 1.00
R8223:Med12l UTSW 3 58,993,784 (GRCm39) missense possibly damaging 0.79
R8560:Med12l UTSW 3 58,945,026 (GRCm39) missense probably damaging 1.00
R8708:Med12l UTSW 3 59,159,751 (GRCm39) missense probably benign 0.00
R8865:Med12l UTSW 3 58,979,303 (GRCm39) missense probably benign
R8947:Med12l UTSW 3 58,984,443 (GRCm39) splice site probably benign
R8976:Med12l UTSW 3 59,183,329 (GRCm39) missense probably damaging 0.99
R9016:Med12l UTSW 3 59,163,294 (GRCm39) missense probably damaging 0.96
R9183:Med12l UTSW 3 58,984,498 (GRCm39) missense probably damaging 1.00
R9487:Med12l UTSW 3 59,155,353 (GRCm39) missense probably benign
R9526:Med12l UTSW 3 58,984,207 (GRCm39) missense probably damaging 0.96
R9802:Med12l UTSW 3 59,169,346 (GRCm39) missense probably damaging 1.00
RF004:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF011:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF013:Med12l UTSW 3 59,183,387 (GRCm39) small insertion probably benign
RF020:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
RF021:Med12l UTSW 3 58,980,711 (GRCm39) missense probably benign 0.19
RF027:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF030:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,408 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF037:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF049:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF050:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF053:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF055:Med12l UTSW 3 59,183,404 (GRCm39) small insertion probably benign
RF056:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF057:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
X0062:Med12l UTSW 3 59,140,600 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 59,203,538 (GRCm39) missense probably benign 0.00
Z1176:Med12l UTSW 3 59,152,364 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 58,998,838 (GRCm39) missense probably damaging 0.98
Z1177:Med12l UTSW 3 59,155,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCTGTTCAAAAGTAAAGC -3'
(R):5'- TGCTTTTCAAAATGGACCACC -3'

Sequencing Primer
(F):5'- TGCCTGTTCAAAAGTAAAGCAGACC -3'
(R):5'- TGTCTACAGCCAAACCAAGAAC -3'
Posted On 2014-10-30