Incidental Mutation 'R2290:Letm1'
ID 244254
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Name leucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 040289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R2290 (G1)
Quality Score 217
Status Validated
Chromosome 5
Chromosomal Location 33739673-33782817 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) A to AG at 33769515 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
AlphaFold Q9Z2I0
Predicted Effect probably null
Transcript: ENSMUST00000005431
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144071
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201981
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,527,313 D62G probably damaging Het
Ambp T C 4: 63,143,687 Y335C probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Asb13 G A 13: 3,649,418 G206D probably damaging Het
Ccdc7b A G 8: 129,131,106 probably benign Het
Cdh15 A T 8: 122,859,317 N145I probably damaging Het
Celsr3 T C 9: 108,843,224 I2565T probably damaging Het
Cfap43 A T 19: 47,773,135 M840K probably damaging Het
Clip4 T C 17: 71,810,953 V331A possibly damaging Het
Cnnm1 A G 19: 43,491,502 T829A probably benign Het
Col24a1 G A 3: 145,513,195 G1457E probably damaging Het
D6Ertd527e A G 6: 87,111,545 N230S unknown Het
Dll1 T C 17: 15,374,748 D89G probably benign Het
Dst T A 1: 34,229,200 V2901E probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Efl1 A T 7: 82,777,670 K1125N probably damaging Het
Efr3a T A 15: 65,849,839 F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,926,942 probably benign Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Gm38999 A G 7: 43,427,699 E5G probably benign Het
Gm5828 C T 1: 16,768,344 noncoding transcript Het
Gnas T C 2: 174,300,010 F717L probably benign Het
H6pd T A 4: 149,981,881 S683C probably damaging Het
Il23r G A 6: 67,423,861 T495I probably benign Het
Itpr2 T C 6: 146,422,828 N135D probably damaging Het
Kcns2 T A 15: 34,838,509 L6Q possibly damaging Het
Khdrbs3 C T 15: 69,029,761 R132C probably damaging Het
Kif2b A G 11: 91,575,696 V587A probably benign Het
Kng1 A T 16: 23,079,125 H425L possibly damaging Het
Lrrc8e T C 8: 4,231,770 M35T probably damaging Het
Med12l A G 3: 59,244,938 N1048S probably damaging Het
Mex3c A C 18: 73,590,693 N619T probably damaging Het
Mfsd4b1 G A 10: 40,003,331 T190I probably damaging Het
Ncam1 A G 9: 49,523,651 probably benign Het
Nlrp6 G A 7: 140,922,163 G133S probably damaging Het
Olfr1385 A G 11: 49,495,030 M166V probably benign Het
Olfr385 G T 11: 73,588,919 A273D probably benign Het
Olfr957 A G 9: 39,511,678 L14P possibly damaging Het
Olfr994 C T 2: 85,430,200 V210M possibly damaging Het
Oplah A G 15: 76,302,725 V630A probably benign Het
Papd5 T C 8: 88,251,975 S435P probably damaging Het
Pcnx2 A T 8: 125,877,595 probably benign Het
Pkhd1l1 A T 15: 44,528,250 T1571S probably benign Het
Pramef12 T A 4: 144,394,699 T252S probably benign Het
Pramef12 G T 4: 144,395,122 H111N probably benign Het
Prr22 T G 17: 56,771,884 F346V probably benign Het
Prr30 T C 14: 101,198,775 N117S possibly damaging Het
Ptgfrn A G 3: 101,077,361 S172P possibly damaging Het
Ptprc C T 1: 138,111,188 V364I probably benign Het
Ptprz1 T C 6: 23,000,991 S1027P probably damaging Het
Rinl T C 7: 28,792,271 V83A probably benign Het
Ros1 A T 10: 52,118,381 S1268T probably damaging Het
Scly T C 1: 91,298,450 probably null Het
Slc25a1 C T 16: 17,925,848 V186M possibly damaging Het
Stk36 T G 1: 74,626,144 probably benign Het
Syn2 A G 6: 115,274,229 T449A possibly damaging Het
Tecpr1 T C 5: 144,214,063 D309G probably damaging Het
Tns2 T A 15: 102,112,023 Y775N probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ttl G A 2: 129,081,270 G177D possibly damaging Het
Twf1 A G 15: 94,586,519 S41P probably damaging Het
Unc79 C T 12: 103,146,366 T2174M probably damaging Het
Vangl2 T A 1: 172,008,546 K340* probably null Het
Vmn2r72 T A 7: 85,738,341 T672S probably damaging Het
Vwa7 A G 17: 35,017,211 D47G probably damaging Het
Zc3h12d A G 10: 7,867,459 H331R probably benign Het
Zfa-ps T C 10: 52,545,016 noncoding transcript Het
Zfp141 A T 7: 42,475,225 C608S probably damaging Het
Zfp422 A G 6: 116,626,642 I132T possibly damaging Het
Zfp652 A G 11: 95,750,023 Y258C possibly damaging Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33762505 missense probably damaging 1.00
R9028:Letm1 UTSW 5 33752503 missense probably damaging 1.00
R9061:Letm1 UTSW 5 33760869 missense probably damaging 1.00
R9420:Letm1 UTSW 5 33769458 missense probably damaging 1.00
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGTTTTATCCAGAGGAGTAG -3'
(R):5'- AACATGGACACCTGCCTCTG -3'

Sequencing Primer
(F):5'- TTTATCCAGAGGAGTAGAGCATAACC -3'
(R):5'- CTCTGCAAGGCTGGTGGTTAC -3'
Posted On 2014-10-30