Mutagenetix > Incidental Mutations

Incidental Mutation 'R2290:Letm1'

244254

Institutional Source

Beutler Lab

Gene Symbol

Letm1

Ensembl Gene

ENSMUSG00000005299

Gene Name

leucine zipper-EF-hand containing transmembrane protein 1

Synonyms

MMRRC Submission

040289-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R2290 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

33739673-33782817 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

A to AG at 33769515 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000005431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005431]

Predicted Effect

probably null
Transcript: ENSMUST00000005431

SMART Domains

Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

Domain	Start	End	E-Value	Type
low complexity region	10	30	N/A	INTRINSIC
low complexity region	120	135	N/A	INTRINSIC
Pfam:LETM1	152	417	1.2e-111	PFAM
coiled coil region	445	493	N/A	INTRINSIC
low complexity region	503	513	N/A	INTRINSIC
coiled coil region	537	598	N/A	INTRINSIC
SCOP:d1c7va_	647	691	4e-3	SMART
coiled coil region	708	738	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144071

Predicted Effect

probably benign
Transcript: ENSMUST00000200827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201981

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	T	C	10: 83,527,313	D62G	probably damaging	Het
Ambp	T	C	4: 63,143,687	Y335C	probably damaging	Het
Arid4a	G	T	12: 71,061,541	G40V	probably damaging	Het
Asb13	G	A	13: 3,649,418	G206D	probably damaging	Het
Ccdc7b	A	G	8: 129,131,106		probably benign	Het
Cdh15	A	T	8: 122,859,317	N145I	probably damaging	Het
Celsr3	T	C	9: 108,843,224	I2565T	probably damaging	Het
Cfap43	A	T	19: 47,773,135	M840K	probably damaging	Het
Clip4	T	C	17: 71,810,953	V331A	possibly damaging	Het
Cnnm1	A	G	19: 43,491,502	T829A	probably benign	Het
Col24a1	G	A	3: 145,513,195	G1457E	probably damaging	Het
D6Ertd527e	A	G	6: 87,111,545	N230S	unknown	Het
Dll1	T	C	17: 15,374,748	D89G	probably benign	Het
Dst	T	A	1: 34,229,200	V2901E	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Efl1	A	T	7: 82,777,670	K1125N	probably damaging	Het
Efr3a	T	A	15: 65,849,839	F437L	probably benign	Het
Eqtn	GTTCTTCTTC	GTTCTTC	4: 94,926,942		probably benign	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Gm38999	A	G	7: 43,427,699	E5G	probably benign	Het
Gm5828	C	T	1: 16,768,344		noncoding transcript	Het
Gnas	T	C	2: 174,300,010	F717L	probably benign	Het
H6pd	T	A	4: 149,981,881	S683C	probably damaging	Het
Il23r	G	A	6: 67,423,861	T495I	probably benign	Het
Itpr2	T	C	6: 146,422,828	N135D	probably damaging	Het
Kcns2	T	A	15: 34,838,509	L6Q	possibly damaging	Het
Khdrbs3	C	T	15: 69,029,761	R132C	probably damaging	Het
Kif2b	A	G	11: 91,575,696	V587A	probably benign	Het
Kng1	A	T	16: 23,079,125	H425L	possibly damaging	Het
Lrrc8e	T	C	8: 4,231,770	M35T	probably damaging	Het
Med12l	A	G	3: 59,244,938	N1048S	probably damaging	Het
Mex3c	A	C	18: 73,590,693	N619T	probably damaging	Het
Mfsd4b1	G	A	10: 40,003,331	T190I	probably damaging	Het
Ncam1	A	G	9: 49,523,651		probably benign	Het
Nlrp6	G	A	7: 140,922,163	G133S	probably damaging	Het
Olfr1385	A	G	11: 49,495,030	M166V	probably benign	Het
Olfr385	G	T	11: 73,588,919	A273D	probably benign	Het
Olfr957	A	G	9: 39,511,678	L14P	possibly damaging	Het
Olfr994	C	T	2: 85,430,200	V210M	possibly damaging	Het
Oplah	A	G	15: 76,302,725	V630A	probably benign	Het
Papd5	T	C	8: 88,251,975	S435P	probably damaging	Het
Pcnx2	A	T	8: 125,877,595		probably benign	Het
Pkhd1l1	A	T	15: 44,528,250	T1571S	probably benign	Het
Pramef12	T	A	4: 144,394,699	T252S	probably benign	Het
Pramef12	G	T	4: 144,395,122	H111N	probably benign	Het
Prr22	T	G	17: 56,771,884	F346V	probably benign	Het
Prr30	T	C	14: 101,198,775	N117S	possibly damaging	Het
Ptgfrn	A	G	3: 101,077,361	S172P	possibly damaging	Het
Ptprc	C	T	1: 138,111,188	V364I	probably benign	Het
Ptprz1	T	C	6: 23,000,991	S1027P	probably damaging	Het
Rinl	T	C	7: 28,792,271	V83A	probably benign	Het
Ros1	A	T	10: 52,118,381	S1268T	probably damaging	Het
Scly	T	C	1: 91,298,450		probably null	Het
Slc25a1	C	T	16: 17,925,848	V186M	possibly damaging	Het
Stk36	T	G	1: 74,626,144		probably benign	Het
Syn2	A	G	6: 115,274,229	T449A	possibly damaging	Het
Tecpr1	T	C	5: 144,214,063	D309G	probably damaging	Het
Tns2	T	A	15: 102,112,023	Y775N	probably damaging	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Ttl	G	A	2: 129,081,270	G177D	possibly damaging	Het
Twf1	A	G	15: 94,586,519	S41P	probably damaging	Het
Unc79	C	T	12: 103,146,366	T2174M	probably damaging	Het
Vangl2	T	A	1: 172,008,546	K340*	probably null	Het
Vmn2r72	T	A	7: 85,738,341	T672S	probably damaging	Het
Vwa7	A	G	17: 35,017,211	D47G	probably damaging	Het
Zc3h12d	A	G	10: 7,867,459	H331R	probably benign	Het
Zfa-ps	T	C	10: 52,545,016		noncoding transcript	Het
Zfp141	A	T	7: 42,475,225	C608S	probably damaging	Het
Zfp422	A	G	6: 116,626,642	I132T	possibly damaging	Het
Zfp652	A	G	11: 95,750,023	Y258C	possibly damaging	Het

Other mutations in Letm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Letm1	APN	5	33762590	missense	possibly damaging	0.82
IGL01073:Letm1	APN	5	33748800	missense	possibly damaging	0.89
IGL01882:Letm1	APN	5	33769665	missense	probably benign	0.00
IGL02186:Letm1	APN	5	33745047	missense	probably benign	0.00
IGL02699:Letm1	APN	5	33745148	missense	possibly damaging	0.93
IGL03089:Letm1	APN	5	33760858	missense	probably damaging	1.00
R0466:Letm1	UTSW	5	33761730	splice site	probably benign
R0639:Letm1	UTSW	5	33769426	missense	possibly damaging	0.88
R1370:Letm1	UTSW	5	33778682	splice site	probably null
R1415:Letm1	UTSW	5	33769562	missense	probably benign	0.06
R1511:Letm1	UTSW	5	33752555	missense	probably damaging	1.00
R1714:Letm1	UTSW	5	33760884	missense	possibly damaging	0.51
R1771:Letm1	UTSW	5	33769467	missense	probably damaging	1.00
R1990:Letm1	UTSW	5	33769515	frame shift	probably null
R1991:Letm1	UTSW	5	33769515	frame shift	probably null
R2143:Letm1	UTSW	5	33769515	frame shift	probably null
R2145:Letm1	UTSW	5	33769515	frame shift	probably null
R2202:Letm1	UTSW	5	33769486	missense	possibly damaging	0.64
R2292:Letm1	UTSW	5	33769515	frame shift	probably null
R5574:Letm1	UTSW	5	33769386	missense	possibly damaging	0.46
R6954:Letm1	UTSW	5	33782507	missense	probably benign	0.35
R7265:Letm1	UTSW	5	33778648	missense	possibly damaging	0.62
R8713:Letm1	UTSW	5	33762505	missense	probably damaging	1.00
S24628:Letm1	UTSW	5	33747444	missense	probably benign	0.00
S24628:Letm1	UTSW	5	33747446	missense	probably benign
X0066:Letm1	UTSW	5	33762571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACGTTTTATCCAGAGGAGTAG -3'
(R):5'- AACATGGACACCTGCCTCTG -3'

Sequencing Primer
(F):5'- TTTATCCAGAGGAGTAGAGCATAACC -3'
(R):5'- CTCTGCAAGGCTGGTGGTTAC -3'

Posted On

2014-10-30