Incidental Mutation 'R0277:Wdfy4'
ID24426
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 038499-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0277 (G1)
Quality Score218
Status Validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33083785 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1735 (D1735G)
Ref Sequence ENSEMBL: ENSMUSP00000057556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061753
AA Change: D1735G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: D1735G

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130509
AA Change: D1780G

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: D1780G

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.0931 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.3%
Validation Efficiency 99% (111/112)
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik A G 7: 125,318,643 K69R unknown Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Acad11 T C 9: 104,124,025 M708T probably damaging Het
Adam7 T C 14: 68,510,857 probably null Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Ak3 A G 19: 29,047,792 M13T possibly damaging Het
Ap2s1 T C 7: 16,747,380 probably benign Het
Arhgef1 A T 7: 24,923,799 probably benign Het
Arsk T C 13: 76,074,932 N182S probably benign Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Atp8b3 T C 10: 80,526,909 K672E probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Casp6 T A 3: 129,910,523 V86E probably benign Het
Cdca5 A G 19: 6,090,712 E260G unknown Het
Cpb2 T A 14: 75,265,458 V159D probably damaging Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dync2h1 T C 9: 7,129,046 D1823G probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgbp G T 7: 28,085,493 probably null Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Gldc A G 19: 30,116,451 I722T possibly damaging Het
Gm10717 T G 9: 3,025,619 V68G possibly damaging Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gnl3 A C 14: 31,013,427 probably null Het
Gsto1 A T 19: 47,857,977 I88F probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hipk3 T A 2: 104,441,248 L446F probably damaging Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hsd17b6 T C 10: 127,991,405 D266G probably benign Het
Ipo4 T C 14: 55,632,115 S363G probably benign Het
Kcnip3 A G 2: 127,459,979 probably benign Het
Klhl41 A G 2: 69,671,296 Y367C probably damaging Het
Klk1b4 C G 7: 44,211,629 P232R possibly damaging Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Mark1 A G 1: 184,944,952 S34P possibly damaging Het
Megf11 G A 9: 64,691,350 probably null Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Muc4 C A 16: 32,755,690 probably benign Het
Myo18b A G 5: 112,693,347 probably benign Het
Myo9b T C 8: 71,355,952 probably benign Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg3 A G 2: 156,934,935 probably benign Het
Nfe2l3 T A 6: 51,457,468 M336K probably benign Het
Nrxn1 A C 17: 90,700,742 probably null Het
Nsun3 A T 16: 62,776,644 probably benign Het
Nuak1 T C 10: 84,374,451 E591G probably benign Het
Olfr1347 T A 7: 6,488,434 M147L probably benign Het
Olfr1511 T C 14: 52,390,389 Y128C probably damaging Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr730 T C 14: 50,186,332 N296S probably null Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Olfr982 G A 9: 40,074,714 V140I probably benign Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Ovgp1 T C 3: 105,979,892 probably benign Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pdk4 G T 6: 5,491,620 P100Q probably damaging Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Prune2 A T 19: 17,121,389 D1419V probably damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Rab11fip4 A G 11: 79,686,629 H403R possibly damaging Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Ric8a T G 7: 140,857,900 probably benign Het
Rsbn1 T C 3: 103,914,581 F44S possibly damaging Het
Serpinc1 T A 1: 160,989,702 M1K probably null Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Sipa1 A T 19: 5,654,065 M743K probably benign Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slco6b1 A T 1: 96,988,673 noncoding transcript Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Sort1 T C 3: 108,324,592 probably benign Het
Spg21 A T 9: 65,465,347 K20N possibly damaging Het
Sptbn2 A T 19: 4,745,145 I1544F probably benign Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Ssbp2 T A 13: 91,564,596 probably benign Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Sv2b A T 7: 75,206,439 D34E possibly damaging Het
Synpo2l A G 14: 20,661,788 S255P probably damaging Het
Tbx15 C T 3: 99,352,391 P526L probably damaging Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tgm1 C A 14: 55,710,927 probably benign Het
Tgm1 T C 14: 55,712,652 probably benign Het
Thsd7b A G 1: 130,195,263 I1540V probably benign Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Ube2l6 A T 2: 84,806,427 probably null Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wnt5a A T 14: 28,513,268 M70L possibly damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfp455 G T 13: 67,198,664 probably null Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
dodgers UTSW 14 32977106 nonsense probably null
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
gigantea UTSW 14 32974154 critical splice donor site probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7946:Wdfy4 UTSW 14 33070748 missense
R7946:Wdfy4 UTSW 14 33104115 missense
R7986:Wdfy4 UTSW 14 33104115 missense
R7990:Wdfy4 UTSW 14 33097795 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
R8090:Wdfy4 UTSW 14 33104115 missense
R8092:Wdfy4 UTSW 14 33104115 missense
R8112:Wdfy4 UTSW 14 33104115 missense
R8114:Wdfy4 UTSW 14 33104115 missense
R8115:Wdfy4 UTSW 14 33104115 missense
R8117:Wdfy4 UTSW 14 32977106 nonsense probably null
R8117:Wdfy4 UTSW 14 33104115 missense
R8118:Wdfy4 UTSW 14 33104115 missense
R8140:Wdfy4 UTSW 14 33142360 missense
R8155:Wdfy4 UTSW 14 33162819 missense
R8163:Wdfy4 UTSW 14 33151588 missense
R8293:Wdfy4 UTSW 14 32974261 missense
R8325:Wdfy4 UTSW 14 32967487 missense
R8370:Wdfy4 UTSW 14 33093251 missense
R8437:Wdfy4 UTSW 14 33076375 missense
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- GCTGAAATTGACCTTGAACTGCACC -3'
(R):5'- ACACCAAGACTCTGGAAGATGTCCC -3'

Sequencing Primer
(F):5'- CAGTCAAGTTGCTTAACGTGC -3'
(R):5'- GAAGATGTCCCCCTGTATTGTAGC -3'
Posted On2013-04-16