Incidental Mutation 'R2290:Zfp422'
ID244262
Institutional Source Beutler Lab
Gene Symbol Zfp422
Ensembl Gene ENSMUSG00000059878
Gene Namezinc finger protein 422
SynonymsKrox26, 2900028O21Rik, Krox-26, Krox25, KOX15, Krox-25-2
MMRRC Submission 040289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2290 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116624016-116628999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116626642 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 132 (I132T)
Ref Sequence ENSEMBL: ENSMUSP00000108501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057540] [ENSMUST00000079749] [ENSMUST00000112880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057540
AA Change: I132T

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084926
Gene: ENSMUSG00000059878
AA Change: I132T

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079749
AA Change: I132T

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078685
Gene: ENSMUSG00000059878
AA Change: I132T

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112880
AA Change: I132T

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108501
Gene: ENSMUSG00000059878
AA Change: I132T

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204559
Meta Mutation Damage Score 0.1853 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes a putative C2H2 zinc finger transcription factor that may play a role in tooth development. A pseudogene related to this gene is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,527,313 D62G probably damaging Het
Ambp T C 4: 63,143,687 Y335C probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Asb13 G A 13: 3,649,418 G206D probably damaging Het
Ccdc7b A G 8: 129,131,106 probably benign Het
Cdh15 A T 8: 122,859,317 N145I probably damaging Het
Celsr3 T C 9: 108,843,224 I2565T probably damaging Het
Cfap43 A T 19: 47,773,135 M840K probably damaging Het
Clip4 T C 17: 71,810,953 V331A possibly damaging Het
Cnnm1 A G 19: 43,491,502 T829A probably benign Het
Col24a1 G A 3: 145,513,195 G1457E probably damaging Het
D6Ertd527e A G 6: 87,111,545 N230S unknown Het
Dll1 T C 17: 15,374,748 D89G probably benign Het
Dst T A 1: 34,229,200 V2901E probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Efl1 A T 7: 82,777,670 K1125N probably damaging Het
Efr3a T A 15: 65,849,839 F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,926,942 probably benign Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Gm38999 A G 7: 43,427,699 E5G probably benign Het
Gm5828 C T 1: 16,768,344 noncoding transcript Het
Gnas T C 2: 174,300,010 F717L probably benign Het
H6pd T A 4: 149,981,881 S683C probably damaging Het
Il23r G A 6: 67,423,861 T495I probably benign Het
Itpr2 T C 6: 146,422,828 N135D probably damaging Het
Kcns2 T A 15: 34,838,509 L6Q possibly damaging Het
Khdrbs3 C T 15: 69,029,761 R132C probably damaging Het
Kif2b A G 11: 91,575,696 V587A probably benign Het
Kng1 A T 16: 23,079,125 H425L possibly damaging Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc8e T C 8: 4,231,770 M35T probably damaging Het
Med12l A G 3: 59,244,938 N1048S probably damaging Het
Mex3c A C 18: 73,590,693 N619T probably damaging Het
Mfsd4b1 G A 10: 40,003,331 T190I probably damaging Het
Ncam1 A G 9: 49,523,651 probably benign Het
Nlrp6 G A 7: 140,922,163 G133S probably damaging Het
Olfr1385 A G 11: 49,495,030 M166V probably benign Het
Olfr385 G T 11: 73,588,919 A273D probably benign Het
Olfr957 A G 9: 39,511,678 L14P possibly damaging Het
Olfr994 C T 2: 85,430,200 V210M possibly damaging Het
Oplah A G 15: 76,302,725 V630A probably benign Het
Papd5 T C 8: 88,251,975 S435P probably damaging Het
Pcnx2 A T 8: 125,877,595 probably benign Het
Pkhd1l1 A T 15: 44,528,250 T1571S probably benign Het
Pramef12 T A 4: 144,394,699 T252S probably benign Het
Pramef12 G T 4: 144,395,122 H111N probably benign Het
Prr22 T G 17: 56,771,884 F346V probably benign Het
Prr30 T C 14: 101,198,775 N117S possibly damaging Het
Ptgfrn A G 3: 101,077,361 S172P possibly damaging Het
Ptprc C T 1: 138,111,188 V364I probably benign Het
Ptprz1 T C 6: 23,000,991 S1027P probably damaging Het
Rinl T C 7: 28,792,271 V83A probably benign Het
Ros1 A T 10: 52,118,381 S1268T probably damaging Het
Scly T C 1: 91,298,450 probably null Het
Slc25a1 C T 16: 17,925,848 V186M possibly damaging Het
Stk36 T G 1: 74,626,144 probably benign Het
Syn2 A G 6: 115,274,229 T449A possibly damaging Het
Tecpr1 T C 5: 144,214,063 D309G probably damaging Het
Tns2 T A 15: 102,112,023 Y775N probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ttl G A 2: 129,081,270 G177D possibly damaging Het
Twf1 A G 15: 94,586,519 S41P probably damaging Het
Unc79 C T 12: 103,146,366 T2174M probably damaging Het
Vangl2 T A 1: 172,008,546 K340* probably null Het
Vmn2r72 T A 7: 85,738,341 T672S probably damaging Het
Vwa7 A G 17: 35,017,211 D47G probably damaging Het
Zc3h12d A G 10: 7,867,459 H331R probably benign Het
Zfa-ps T C 10: 52,545,016 noncoding transcript Het
Zfp141 A T 7: 42,475,225 C608S probably damaging Het
Zfp652 A G 11: 95,750,023 Y258C possibly damaging Het
Other mutations in Zfp422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp422 APN 6 116626958 missense probably benign 0.00
IGL00659:Zfp422 APN 6 116626505 nonsense probably null
IGL03199:Zfp422 APN 6 116626951 missense probably benign 0.43
R0190:Zfp422 UTSW 6 116626611 missense probably damaging 1.00
R1572:Zfp422 UTSW 6 116626784 missense probably damaging 1.00
R1756:Zfp422 UTSW 6 116626424 missense probably benign 0.00
R3724:Zfp422 UTSW 6 116626379 missense probably benign 0.00
R3932:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R3933:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R4700:Zfp422 UTSW 6 116626883 missense possibly damaging 0.59
R4806:Zfp422 UTSW 6 116626662 missense probably damaging 1.00
R4957:Zfp422 UTSW 6 116626943 nonsense probably null
R5784:Zfp422 UTSW 6 116626810 missense probably damaging 1.00
R6361:Zfp422 UTSW 6 116626820 missense probably damaging 1.00
R8303:Zfp422 UTSW 6 116626651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCATGTGCTGCCTCAG -3'
(R):5'- GAAGCCTTACAAGTGTGCTAAATG -3'

Sequencing Primer
(F):5'- CATGTGCTGCCTCAGATGGG -3'
(R):5'- TGCTCCAAGAGTTTCAGTCAGAGC -3'
Posted On2014-10-30