Incidental Mutation 'R2290:Nlrp6'
ID 244270
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 040289-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R2290 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140500815-140509105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 140502076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 133 (G133S)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect probably damaging
Transcript: ENSMUST00000106045
AA Change: G103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: G103S

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably damaging
Transcript: ENSMUST00000183845
AA Change: G103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: G103S

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000184560
AA Change: G133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: G133S

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,363,177 (GRCm39) D62G probably damaging Het
Ambp T C 4: 63,061,924 (GRCm39) Y335C probably damaging Het
Arid4a G T 12: 71,108,315 (GRCm39) G40V probably damaging Het
Asb13 G A 13: 3,699,418 (GRCm39) G206D probably damaging Het
Ccdc7b A G 8: 129,857,587 (GRCm39) probably benign Het
Cdh15 A T 8: 123,586,056 (GRCm39) N145I probably damaging Het
Celsr3 T C 9: 108,720,423 (GRCm39) I2565T probably damaging Het
Cfap43 A T 19: 47,761,574 (GRCm39) M840K probably damaging Het
Clip4 T C 17: 72,117,948 (GRCm39) V331A possibly damaging Het
Cnnm1 A G 19: 43,479,941 (GRCm39) T829A probably benign Het
Col24a1 G A 3: 145,218,950 (GRCm39) G1457E probably damaging Het
D6Ertd527e A G 6: 87,088,527 (GRCm39) N230S unknown Het
Dll1 T C 17: 15,595,010 (GRCm39) D89G probably benign Het
Dst T A 1: 34,268,281 (GRCm39) V2901E probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Efl1 A T 7: 82,426,878 (GRCm39) K1125N probably damaging Het
Efr3a T A 15: 65,721,688 (GRCm39) F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,815,179 (GRCm39) probably benign Het
Ermp1 T C 19: 29,601,178 (GRCm39) D523G probably damaging Het
Gm38999 A G 7: 43,077,123 (GRCm39) E5G probably benign Het
Gm5828 C T 1: 16,838,568 (GRCm39) noncoding transcript Het
Gnas T C 2: 174,141,803 (GRCm39) F717L probably benign Het
H6pd T A 4: 150,066,338 (GRCm39) S683C probably damaging Het
Il23r G A 6: 67,400,845 (GRCm39) T495I probably benign Het
Itpr2 T C 6: 146,324,326 (GRCm39) N135D probably damaging Het
Kcns2 T A 15: 34,838,655 (GRCm39) L6Q possibly damaging Het
Khdrbs3 C T 15: 68,901,610 (GRCm39) R132C probably damaging Het
Kif2b A G 11: 91,466,522 (GRCm39) V587A probably benign Het
Kng1 A T 16: 22,897,875 (GRCm39) H425L possibly damaging Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lrrc8e T C 8: 4,281,770 (GRCm39) M35T probably damaging Het
Med12l A G 3: 59,152,359 (GRCm39) N1048S probably damaging Het
Mex3c A C 18: 73,723,764 (GRCm39) N619T probably damaging Het
Mfsd4b1 G A 10: 39,879,327 (GRCm39) T190I probably damaging Het
Ncam1 A G 9: 49,434,951 (GRCm39) probably benign Het
Oplah A G 15: 76,186,925 (GRCm39) V630A probably benign Het
Or1e26 G T 11: 73,479,745 (GRCm39) A273D probably benign Het
Or2y1 A G 11: 49,385,857 (GRCm39) M166V probably benign Het
Or5ak24 C T 2: 85,260,544 (GRCm39) V210M possibly damaging Het
Or8g36 A G 9: 39,422,974 (GRCm39) L14P possibly damaging Het
Pcnx2 A T 8: 126,604,334 (GRCm39) probably benign Het
Pkhd1l1 A T 15: 44,391,646 (GRCm39) T1571S probably benign Het
Pramel13 T A 4: 144,121,269 (GRCm39) T252S probably benign Het
Pramel13 G T 4: 144,121,692 (GRCm39) H111N probably benign Het
Prr22 T G 17: 57,078,884 (GRCm39) F346V probably benign Het
Prr30 T C 14: 101,436,211 (GRCm39) N117S possibly damaging Het
Ptgfrn A G 3: 100,984,677 (GRCm39) S172P possibly damaging Het
Ptprc C T 1: 138,038,926 (GRCm39) V364I probably benign Het
Ptprz1 T C 6: 23,000,990 (GRCm39) S1027P probably damaging Het
Rinl T C 7: 28,491,696 (GRCm39) V83A probably benign Het
Ros1 A T 10: 51,994,477 (GRCm39) S1268T probably damaging Het
Scly T C 1: 91,226,172 (GRCm39) probably null Het
Slc25a1 C T 16: 17,743,712 (GRCm39) V186M possibly damaging Het
Stk36 T G 1: 74,665,303 (GRCm39) probably benign Het
Syn2 A G 6: 115,251,190 (GRCm39) T449A possibly damaging Het
Tecpr1 T C 5: 144,150,881 (GRCm39) D309G probably damaging Het
Tent4b T C 8: 88,978,603 (GRCm39) S435P probably damaging Het
Tns2 T A 15: 102,020,458 (GRCm39) Y775N probably damaging Het
Tril G T 6: 53,795,012 (GRCm39) R737S probably damaging Het
Ttl G A 2: 128,923,190 (GRCm39) G177D possibly damaging Het
Twf1 A G 15: 94,484,400 (GRCm39) S41P probably damaging Het
Unc79 C T 12: 103,112,625 (GRCm39) T2174M probably damaging Het
Vangl2 T A 1: 171,836,113 (GRCm39) K340* probably null Het
Vmn2r72 T A 7: 85,387,549 (GRCm39) T672S probably damaging Het
Vwa7 A G 17: 35,236,187 (GRCm39) D47G probably damaging Het
Zc3h12d A G 10: 7,743,223 (GRCm39) H331R probably benign Het
Zfa-ps T C 10: 52,421,112 (GRCm39) noncoding transcript Het
Zfp141 A T 7: 42,124,649 (GRCm39) C608S probably damaging Het
Zfp422 A G 6: 116,603,603 (GRCm39) I132T possibly damaging Het
Zfp652 A G 11: 95,640,849 (GRCm39) Y258C possibly damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140,503,037 (GRCm39) missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140,501,709 (GRCm39) missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140,505,103 (GRCm39) missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140,503,413 (GRCm39) missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140,502,348 (GRCm39) missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140,503,333 (GRCm39) missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140,507,400 (GRCm39) missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140,503,399 (GRCm39) nonsense probably null
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1472:Nlrp6 UTSW 7 140,503,408 (GRCm39) missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140,502,959 (GRCm39) missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140,503,006 (GRCm39) missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R2097:Nlrp6 UTSW 7 140,503,117 (GRCm39) missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R3546:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140,501,568 (GRCm39) missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140,504,006 (GRCm39) missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140,503,497 (GRCm39) missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140,502,630 (GRCm39) nonsense probably null
R5442:Nlrp6 UTSW 7 140,502,103 (GRCm39) missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140,503,403 (GRCm39) missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140,502,725 (GRCm39) nonsense probably null
R6124:Nlrp6 UTSW 7 140,503,160 (GRCm39) missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140,507,422 (GRCm39) missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140,507,356 (GRCm39) missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140,503,433 (GRCm39) missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140,502,780 (GRCm39) missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140,501,191 (GRCm39) start gained probably benign
R7532:Nlrp6 UTSW 7 140,505,097 (GRCm39) missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140,503,168 (GRCm39) missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140,503,754 (GRCm39) missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140,502,743 (GRCm39) missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140,506,332 (GRCm39) missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140,506,561 (GRCm39) splice site probably benign
Z1176:Nlrp6 UTSW 7 140,502,634 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTGGGAAGATCAACTTTGTC -3'
(R):5'- TGCCGCCACTATGGAATCAC -3'

Sequencing Primer
(F):5'- GGGAAGATCAACTTTGTCCACTC -3'
(R):5'- TGCCTGTCTAAATCTGGGC -3'
Posted On 2014-10-30