Incidental Mutation 'R2290:Lrrc8e'
ID 244271
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Name leucine rich repeat containing 8 family, member E
Synonyms 1810049O03Rik, C87354
MMRRC Submission 040289-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R2290 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4276827-4287470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4281770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 35 (M35T)
Ref Sequence ENSEMBL: ENSMUSP00000146637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053035] [ENSMUST00000207770]
AlphaFold Q66JT1
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: M35T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: M35T

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207770
AA Change: M35T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,363,177 (GRCm39) D62G probably damaging Het
Ambp T C 4: 63,061,924 (GRCm39) Y335C probably damaging Het
Arid4a G T 12: 71,108,315 (GRCm39) G40V probably damaging Het
Asb13 G A 13: 3,699,418 (GRCm39) G206D probably damaging Het
Ccdc7b A G 8: 129,857,587 (GRCm39) probably benign Het
Cdh15 A T 8: 123,586,056 (GRCm39) N145I probably damaging Het
Celsr3 T C 9: 108,720,423 (GRCm39) I2565T probably damaging Het
Cfap43 A T 19: 47,761,574 (GRCm39) M840K probably damaging Het
Clip4 T C 17: 72,117,948 (GRCm39) V331A possibly damaging Het
Cnnm1 A G 19: 43,479,941 (GRCm39) T829A probably benign Het
Col24a1 G A 3: 145,218,950 (GRCm39) G1457E probably damaging Het
D6Ertd527e A G 6: 87,088,527 (GRCm39) N230S unknown Het
Dll1 T C 17: 15,595,010 (GRCm39) D89G probably benign Het
Dst T A 1: 34,268,281 (GRCm39) V2901E probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Efl1 A T 7: 82,426,878 (GRCm39) K1125N probably damaging Het
Efr3a T A 15: 65,721,688 (GRCm39) F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,815,179 (GRCm39) probably benign Het
Ermp1 T C 19: 29,601,178 (GRCm39) D523G probably damaging Het
Gm38999 A G 7: 43,077,123 (GRCm39) E5G probably benign Het
Gm5828 C T 1: 16,838,568 (GRCm39) noncoding transcript Het
Gnas T C 2: 174,141,803 (GRCm39) F717L probably benign Het
H6pd T A 4: 150,066,338 (GRCm39) S683C probably damaging Het
Il23r G A 6: 67,400,845 (GRCm39) T495I probably benign Het
Itpr2 T C 6: 146,324,326 (GRCm39) N135D probably damaging Het
Kcns2 T A 15: 34,838,655 (GRCm39) L6Q possibly damaging Het
Khdrbs3 C T 15: 68,901,610 (GRCm39) R132C probably damaging Het
Kif2b A G 11: 91,466,522 (GRCm39) V587A probably benign Het
Kng1 A T 16: 22,897,875 (GRCm39) H425L possibly damaging Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Med12l A G 3: 59,152,359 (GRCm39) N1048S probably damaging Het
Mex3c A C 18: 73,723,764 (GRCm39) N619T probably damaging Het
Mfsd4b1 G A 10: 39,879,327 (GRCm39) T190I probably damaging Het
Ncam1 A G 9: 49,434,951 (GRCm39) probably benign Het
Nlrp6 G A 7: 140,502,076 (GRCm39) G133S probably damaging Het
Oplah A G 15: 76,186,925 (GRCm39) V630A probably benign Het
Or1e26 G T 11: 73,479,745 (GRCm39) A273D probably benign Het
Or2y1 A G 11: 49,385,857 (GRCm39) M166V probably benign Het
Or5ak24 C T 2: 85,260,544 (GRCm39) V210M possibly damaging Het
Or8g36 A G 9: 39,422,974 (GRCm39) L14P possibly damaging Het
Pcnx2 A T 8: 126,604,334 (GRCm39) probably benign Het
Pkhd1l1 A T 15: 44,391,646 (GRCm39) T1571S probably benign Het
Pramel13 T A 4: 144,121,269 (GRCm39) T252S probably benign Het
Pramel13 G T 4: 144,121,692 (GRCm39) H111N probably benign Het
Prr22 T G 17: 57,078,884 (GRCm39) F346V probably benign Het
Prr30 T C 14: 101,436,211 (GRCm39) N117S possibly damaging Het
Ptgfrn A G 3: 100,984,677 (GRCm39) S172P possibly damaging Het
Ptprc C T 1: 138,038,926 (GRCm39) V364I probably benign Het
Ptprz1 T C 6: 23,000,990 (GRCm39) S1027P probably damaging Het
Rinl T C 7: 28,491,696 (GRCm39) V83A probably benign Het
Ros1 A T 10: 51,994,477 (GRCm39) S1268T probably damaging Het
Scly T C 1: 91,226,172 (GRCm39) probably null Het
Slc25a1 C T 16: 17,743,712 (GRCm39) V186M possibly damaging Het
Stk36 T G 1: 74,665,303 (GRCm39) probably benign Het
Syn2 A G 6: 115,251,190 (GRCm39) T449A possibly damaging Het
Tecpr1 T C 5: 144,150,881 (GRCm39) D309G probably damaging Het
Tent4b T C 8: 88,978,603 (GRCm39) S435P probably damaging Het
Tns2 T A 15: 102,020,458 (GRCm39) Y775N probably damaging Het
Tril G T 6: 53,795,012 (GRCm39) R737S probably damaging Het
Ttl G A 2: 128,923,190 (GRCm39) G177D possibly damaging Het
Twf1 A G 15: 94,484,400 (GRCm39) S41P probably damaging Het
Unc79 C T 12: 103,112,625 (GRCm39) T2174M probably damaging Het
Vangl2 T A 1: 171,836,113 (GRCm39) K340* probably null Het
Vmn2r72 T A 7: 85,387,549 (GRCm39) T672S probably damaging Het
Vwa7 A G 17: 35,236,187 (GRCm39) D47G probably damaging Het
Zc3h12d A G 10: 7,743,223 (GRCm39) H331R probably benign Het
Zfa-ps T C 10: 52,421,112 (GRCm39) noncoding transcript Het
Zfp141 A T 7: 42,124,649 (GRCm39) C608S probably damaging Het
Zfp422 A G 6: 116,603,603 (GRCm39) I132T possibly damaging Het
Zfp652 A G 11: 95,640,849 (GRCm39) Y258C possibly damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4,285,921 (GRCm39) missense probably benign
IGL00943:Lrrc8e APN 8 4,285,658 (GRCm39) missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4,285,080 (GRCm39) missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4,284,084 (GRCm39) missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4,286,141 (GRCm39) missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4,285,392 (GRCm39) missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4,285,429 (GRCm39) missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4,285,776 (GRCm39) missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4,285,733 (GRCm39) missense probably benign
R0601:Lrrc8e UTSW 8 4,285,239 (GRCm39) splice site probably null
R1167:Lrrc8e UTSW 8 4,285,337 (GRCm39) missense probably benign
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4,284,990 (GRCm39) missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4,284,190 (GRCm39) missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4,285,202 (GRCm39) missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4,284,986 (GRCm39) nonsense probably null
R3424:Lrrc8e UTSW 8 4,284,611 (GRCm39) missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4,283,981 (GRCm39) missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4,285,166 (GRCm39) missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4,284,329 (GRCm39) missense probably benign
R5516:Lrrc8e UTSW 8 4,285,818 (GRCm39) missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4,285,725 (GRCm39) missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4,284,798 (GRCm39) missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4,286,034 (GRCm39) missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4,284,815 (GRCm39) missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4,285,626 (GRCm39) missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4,284,363 (GRCm39) missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4,284,534 (GRCm39) missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4,285,575 (GRCm39) missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4,285,140 (GRCm39) missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4,285,641 (GRCm39) missense probably damaging 1.00
R8355:Lrrc8e UTSW 8 4,284,018 (GRCm39) missense probably benign 0.02
R8487:Lrrc8e UTSW 8 4,284,218 (GRCm39) missense probably damaging 1.00
R8810:Lrrc8e UTSW 8 4,285,070 (GRCm39) missense probably benign 0.03
R8971:Lrrc8e UTSW 8 4,284,141 (GRCm39) missense probably damaging 1.00
R9088:Lrrc8e UTSW 8 4,284,410 (GRCm39) missense probably damaging 0.96
R9150:Lrrc8e UTSW 8 4,286,030 (GRCm39) missense probably benign 0.06
R9225:Lrrc8e UTSW 8 4,284,561 (GRCm39) missense probably damaging 1.00
R9255:Lrrc8e UTSW 8 4,284,504 (GRCm39) missense probably damaging 1.00
R9442:Lrrc8e UTSW 8 4,283,964 (GRCm39) missense probably benign 0.01
R9463:Lrrc8e UTSW 8 4,285,185 (GRCm39) missense probably damaging 0.99
R9475:Lrrc8e UTSW 8 4,285,346 (GRCm39) missense probably benign
Z1176:Lrrc8e UTSW 8 4,284,822 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAGCTATGTCTGGCCTCTC -3'
(R):5'- ACAATGAGAGCCAGATCCCG -3'

Sequencing Primer
(F):5'- TCTCGGGGTTTCCACCAG -3'
(R):5'- ATGAGAGCCAGATCCCGTGTAC -3'
Posted On 2014-10-30