Incidental Mutation 'R2291:Cacna1e'
ID244319
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Namecalcium channel, voltage-dependent, R type, alpha 1E subunit
SynonymsCchra1, alpha1E, Cav2.3
MMRRC Submission 040290-MU
Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location154390731-154884501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154403683 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1720 (D1720G)
Ref Sequence ENSEMBL: ENSMUSP00000004214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
Predicted Effect probably damaging
Transcript: ENSMUST00000004214
AA Change: D1720G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: D1720G

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187541
AA Change: D2028G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: D2028G

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211821
AA Change: D2009G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154403683 missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154471601 missense probably benign 0.04
IGL01302:Cacna1e APN 1 154443907 missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154472377 missense probably benign 0.18
IGL01573:Cacna1e APN 1 154471367 missense probably benign
IGL01676:Cacna1e APN 1 154398476 missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154412450 missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154471373 missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154471340 missense probably null 0.00
IGL01895:Cacna1e APN 1 154443900 missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154421113 missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154403747 missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154426528 missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154493409 missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154445648 missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154465741 missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154471425 missense probably benign 0.15
IGL03120:Cacna1e APN 1 154443881 missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154493358 missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154442251 missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154466944 critical splice donor site probably null
bezoar UTSW 1 154436554 splice site probably null
hairball UTSW 1 154479305 missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154443901 missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154448947 splice site probably null
R0314:Cacna1e UTSW 1 154442251 missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154416138 missense probably benign 0.03
R0626:Cacna1e UTSW 1 154488817 missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154442278 missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154444968 missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154398673 missense probably benign
R1340:Cacna1e UTSW 1 154472657 missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154561806 missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154485662 critical splice donor site probably null
R1538:Cacna1e UTSW 1 154561758 missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154477779 missense probably benign 0.01
R1560:Cacna1e UTSW 1 154421104 nonsense probably null
R1748:Cacna1e UTSW 1 154486569 missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154444000 missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154436449 missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154700494 missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154443845 missense probably damaging 1.00
R2417:Cacna1e UTSW 1 154472193 missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154416085 missense probably benign 0.08
R3757:Cacna1e UTSW 1 154633696 missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154483553 missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154482585 missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154412183 splice site probably null
R4275:Cacna1e UTSW 1 154493325 missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154426550 missense probably benign 0.04
R4297:Cacna1e UTSW 1 154398731 missense probably benign 0.37
R4356:Cacna1e UTSW 1 154443981 missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154402027 missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154436519 missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154471613 missense probably benign
R4622:Cacna1e UTSW 1 154471565 missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154482548 splice site probably null
R4694:Cacna1e UTSW 1 154437266 critical splice donor site probably null
R4727:Cacna1e UTSW 1 154436468 nonsense probably null
R4839:Cacna1e UTSW 1 154421058 missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154436554 splice site probably null
R4894:Cacna1e UTSW 1 154488805 nonsense probably null
R4934:Cacna1e UTSW 1 154481634 nonsense probably null
R4979:Cacna1e UTSW 1 154413993 missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154561729 critical splice donor site probably null
R5128:Cacna1e UTSW 1 154402021 missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154701364 missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154700504 missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154477796 missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154465779 missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154443937 missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154725709 missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154471340 missense probably benign 0.00
R5615:Cacna1e UTSW 1 154412170 missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154442194 missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154635858 missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154633717 missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154471637 missense probably benign 0.00
R5893:Cacna1e UTSW 1 154437323 missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154561791 missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154701291 missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154486570 missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6295:Cacna1e UTSW 1 154442173 missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6320:Cacna1e UTSW 1 154441524 missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154479305 missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154413974 critical splice donor site probably null
R6842:Cacna1e UTSW 1 154483117 missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154725693 missense probably null 0.85
R7081:Cacna1e UTSW 1 154700383 missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154473746 intron probably null
R7108:Cacna1e UTSW 1 154468995 frame shift probably null
R7142:Cacna1e UTSW 1 154412484 missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154700489 missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154725801 missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154472234 missense probably benign 0.13
R7502:Cacna1e UTSW 1 154468988 missense probably null 0.35
R7556:Cacna1e UTSW 1 154472673 missense probably benign 0.28
R7563:Cacna1e UTSW 1 154471416 missense probably benign 0.00
R7573:Cacna1e UTSW 1 154726165 intron probably benign
R7689:Cacna1e UTSW 1 154398803 missense probably benign 0.01
R7744:Cacna1e UTSW 1 154465792 missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154413117 missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154482568 missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154398406 missense probably damaging 1.00
RF008:Cacna1e UTSW 1 154442136 missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154412492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGATCCATCTTGTCAGAGG -3'
(R):5'- GTAACAGACCCTAGCTCTATGC -3'

Sequencing Primer
(F):5'- CGTAAGTTCTAGGGATTTGAACCC -3'
(R):5'- CGACGTTCATTTTCTACAATTCGGG -3'
Posted On2014-10-30