Incidental Mutation 'R0277:Adam7'
ID24432
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission 038499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0277 (G1)
Quality Score205
Status Not validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 68510857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably null
Transcript: ENSMUST00000022640
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128069
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.3%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik A G 7: 125,318,643 K69R unknown Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Acad11 T C 9: 104,124,025 M708T probably damaging Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Ak3 A G 19: 29,047,792 M13T possibly damaging Het
Ap2s1 T C 7: 16,747,380 probably benign Het
Arhgef1 A T 7: 24,923,799 probably benign Het
Arsk T C 13: 76,074,932 N182S probably benign Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Atp8b3 T C 10: 80,526,909 K672E probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Casp6 T A 3: 129,910,523 V86E probably benign Het
Cdca5 A G 19: 6,090,712 E260G unknown Het
Cpb2 T A 14: 75,265,458 V159D probably damaging Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dync2h1 T C 9: 7,129,046 D1823G probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgbp G T 7: 28,085,493 probably null Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Gldc A G 19: 30,116,451 I722T possibly damaging Het
Gm10717 T G 9: 3,025,619 V68G possibly damaging Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gnl3 A C 14: 31,013,427 probably null Het
Gsto1 A T 19: 47,857,977 I88F probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hipk3 T A 2: 104,441,248 L446F probably damaging Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hsd17b6 T C 10: 127,991,405 D266G probably benign Het
Ipo4 T C 14: 55,632,115 S363G probably benign Het
Kcnip3 A G 2: 127,459,979 probably benign Het
Klhl41 A G 2: 69,671,296 Y367C probably damaging Het
Klk1b4 C G 7: 44,211,629 P232R possibly damaging Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Mark1 A G 1: 184,944,952 S34P possibly damaging Het
Megf11 G A 9: 64,691,350 probably null Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Muc4 C A 16: 32,755,690 probably benign Het
Myo18b A G 5: 112,693,347 probably benign Het
Myo9b T C 8: 71,355,952 probably benign Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg3 A G 2: 156,934,935 probably benign Het
Nfe2l3 T A 6: 51,457,468 M336K probably benign Het
Nrxn1 A C 17: 90,700,742 probably null Het
Nsun3 A T 16: 62,776,644 probably benign Het
Nuak1 T C 10: 84,374,451 E591G probably benign Het
Olfr1347 T A 7: 6,488,434 M147L probably benign Het
Olfr1511 T C 14: 52,390,389 Y128C probably damaging Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr730 T C 14: 50,186,332 N296S probably null Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Olfr982 G A 9: 40,074,714 V140I probably benign Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Ovgp1 T C 3: 105,979,892 probably benign Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pdk4 G T 6: 5,491,620 P100Q probably damaging Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Prune2 A T 19: 17,121,389 D1419V probably damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Rab11fip4 A G 11: 79,686,629 H403R possibly damaging Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Ric8a T G 7: 140,857,900 probably benign Het
Rsbn1 T C 3: 103,914,581 F44S possibly damaging Het
Serpinc1 T A 1: 160,989,702 M1K probably null Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Sipa1 A T 19: 5,654,065 M743K probably benign Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slco6b1 A T 1: 96,988,673 noncoding transcript Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Sort1 T C 3: 108,324,592 probably benign Het
Spg21 A T 9: 65,465,347 K20N possibly damaging Het
Sptbn2 A T 19: 4,745,145 I1544F probably benign Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Ssbp2 T A 13: 91,564,596 probably benign Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Sv2b A T 7: 75,206,439 D34E possibly damaging Het
Synpo2l A G 14: 20,661,788 S255P probably damaging Het
Tbx15 C T 3: 99,352,391 P526L probably damaging Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tgm1 C A 14: 55,710,927 probably benign Het
Tgm1 T C 14: 55,712,652 probably benign Het
Thsd7b A G 1: 130,195,263 I1540V probably benign Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Ube2l6 A T 2: 84,806,427 probably null Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Wdfy4 T C 14: 33,083,785 D1735G possibly damaging Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wnt5a A T 14: 28,513,268 M70L possibly damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfp455 G T 13: 67,198,664 probably null Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 intron probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R7951:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAACCAGGGGTTTGTACTGTCCAC -3'
(R):5'- AGTTCCAAGCCAACGGGTTTCC -3'

Sequencing Primer
(F):5'- CTGTCAGAGCAGAAGCCTTTTAATG -3'
(R):5'- CGAGCCAGTGTACAAATGCTTTC -3'
Posted On2013-04-16