Mutagenetix > Incidental Mutation

Incidental Mutation 'R2291:Scn1a'

244323

Institutional Source

Beutler Lab

Gene Symbol

Scn1a

Ensembl Gene

ENSMUSG00000064329

Gene Name

sodium channel, voltage-gated, type I, alpha

Synonyms

Nav1.1

MMRRC Submission

040290-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66270778-66440840 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66288968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1397 (L1397P)

Ref Sequence

ENSEMBL: ENSMUSP00000107985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]

AlphaFold

A2APX8

Predicted Effect

probably benign
Transcript: ENSMUST00000077489
AA Change: L1386P

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: L1386P

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094951
AA Change: L1369P

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: L1369P

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.3e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	691	2e-62	PFAM
Pfam:Ion_trans	774	963	6.7e-47	PFAM
Pfam:Na_trans_assoc	978	1200	1.2e-74	PFAM
Pfam:Ion_trans	1226	1454	1e-56	PFAM
PDB:1BYY\|A	1456	1508	4e-31	PDB
Pfam:Ion_trans	1547	1757	1.1e-51	PFAM
Pfam:PKD_channel	1606	1764	3.8e-7	PFAM
low complexity region	1809	1821	N/A	INTRINSIC
IQ	1886	1908	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112366
AA Change: L1397P

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: L1397P

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	127	434	2.8e-82	PFAM
Pfam:Na_trans_cytopl	502	718	2e-91	PFAM
Pfam:Ion_trans	767	1002	6.5e-57	PFAM
Pfam:Na_trans_assoc	1006	1213	1.2e-60	PFAM
Pfam:Ion_trans	1217	1493	3.3e-67	PFAM
Pfam:Ion_trans	1540	1797	6.3e-56	PFAM
Pfam:PKD_channel	1637	1791	1.1e-6	PFAM
low complexity region	1837	1849	N/A	INTRINSIC
IQ	1914	1936	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112371
AA Change: L1386P

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: L1386P

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156865
AA Change: L366P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329
AA Change: L366P

Domain	Start	End	E-Value	Type
Pfam:Na_trans_assoc	1	182	2.2e-44	PFAM
Pfam:Ion_trans	186	462	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200839

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,413,801	I247N	probably damaging	Het
Afdn	A	G	17: 13,888,891	K1559E	probably damaging	Het
Ankhd1	C	T	18: 36,644,333	T1523I	probably benign	Het
Apc	T	A	18: 34,312,491	N795K	probably benign	Het
Arhgap26	G	T	18: 39,357,698		probably benign	Het
Atm	C	T	9: 53,490,909		probably null	Het
Atp1a4	T	C	1: 172,244,906	N394D	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Cacna1d	G	T	14: 30,042,342	R2078S	probably damaging	Het
Cacna1e	T	C	1: 154,403,683	D1720G	probably damaging	Het
Camk2a	T	A	18: 60,963,959	V38E	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccr7	G	A	11: 99,145,335	R254C	probably damaging	Het
Celf5	C	T	10: 81,467,047	G267D	probably damaging	Het
Cfap65	G	A	1: 74,926,475	P459S	probably damaging	Het
Chd1l	T	C	3: 97,591,283	K267E	probably damaging	Het
Chl1	T	A	6: 103,715,393	Y331N	probably damaging	Het
Cltc	G	A	11: 86,733,622	T158I	probably benign	Het
Col16a1	T	A	4: 130,067,040	D430E	unknown	Het
Cspg4	T	C	9: 56,892,743	V1597A	probably damaging	Het
Cstf2t	T	A	19: 31,084,864	L600H	probably benign	Het
Cyp27b1	T	C	10: 127,048,294	V5A	possibly damaging	Het
Depdc5	C	A	5: 32,979,402	Q1339K	probably damaging	Het
Diaph3	G	T	14: 86,966,446	P592Q	probably damaging	Het
Epha8	T	C	4: 136,933,347	M687V	probably damaging	Het
Fhod1	T	A	8: 105,336,964		probably benign	Het
Gls2	C	A	10: 128,207,610	S73*	probably null	Het
Gm3604	T	A	13: 62,371,843	M33L	probably damaging	Het
Gpr39	A	G	1: 125,677,541	T69A	probably benign	Het
Hal	T	C	10: 93,503,536	F496L	probably damaging	Het
Hipk1	T	C	3: 103,761,610	E490G	probably damaging	Het
Ints7	T	G	1: 191,606,203		probably null	Het
Itpr3	A	G	17: 27,113,579	E1799G	possibly damaging	Het
Kif11	T	A	19: 37,407,003	M570K	probably benign	Het
Kif18b	G	T	11: 102,908,270	Q702K	probably damaging	Het
Kif19a	A	G	11: 114,790,193	T247A	probably damaging	Het
Lama3	A	G	18: 12,525,079	E360G	probably damaging	Het
Loxl3	G	T	6: 83,037,488	A126S	probably benign	Het
Mc5r	C	T	18: 68,339,364	R265W	probably damaging	Het
Mpl	A	G	4: 118,449,000	V340A	probably benign	Het
Mrpl13	G	T	15: 55,548,219	H56Q	probably damaging	Het
Msr1	T	C	8: 39,624,222	T116A	probably benign	Het
N4bp3	T	C	11: 51,646,103	K48E	probably damaging	Het
Naaladl1	A	G	19: 6,106,195	T104A	probably benign	Het
Neu1	C	T	17: 34,932,766	R179W	probably damaging	Het
Olfr1053	A	T	2: 86,315,180	Y35*	probably null	Het
Olfr975	T	C	9: 39,950,334	T146A	probably benign	Het
Osbp	G	T	19: 11,973,834	E248*	probably null	Het
Otx1	T	A	11: 21,996,634		probably benign	Het
Parp4	A	T	14: 56,613,817	Q759L	probably damaging	Het
Pax6	A	C	2: 105,685,883	S169R	probably benign	Het
Pigg	T	G	5: 108,332,917	I389M	probably damaging	Het
Pla2g4a	C	A	1: 149,901,189	V59F	probably damaging	Het
Plcb4	A	T	2: 135,939,983	Q241H	probably benign	Het
Plpp6	A	G	19: 28,964,320	D107G	probably damaging	Het
Ppp6r2	T	A	15: 89,275,487	L459Q	probably damaging	Het
Prss55	A	T	14: 64,075,722	W238R	probably damaging	Het
Rgl1	C	T	1: 152,536,281	E446K	probably damaging	Het
Ric3	C	T	7: 109,038,883	G221D	probably damaging	Het
Rnf167	T	C	11: 70,649,303	F83S	probably damaging	Het
Ryr1	C	T	7: 29,098,777	V947M	probably damaging	Het
Sh3bp1	T	A	15: 78,918,319	V251E	possibly damaging	Het
Slc25a10	A	T	11: 120,497,074	I198L	probably benign	Het
Smoc2	A	T	17: 14,368,971	N234I	possibly damaging	Het
Spdl1	T	A	11: 34,819,309	K382*	probably null	Het
Ssrp1	G	A	2: 85,042,316		probably null	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Triqk	T	A	4: 12,974,817		probably null	Het
Ttc19	T	C	11: 62,283,693	Y128H	probably damaging	Het
Vmn1r15	T	C	6: 57,258,692	S182P	possibly damaging	Het
Vmn1r226	A	G	17: 20,688,213	I236V	probably damaging	Het
Vmn2r120	A	C	17: 57,509,479	N625K	probably damaging	Het
Vmn2r78	T	C	7: 86,920,154	I85T	probably damaging	Het
Wdr60	A	T	12: 116,229,571		probably null	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt7a	C	T	6: 91,394,486	V165I	probably benign	Het
Zbtb40	A	T	4: 136,985,017	Y1127N	possibly damaging	Het
Zfyve1	A	T	12: 83,547,931	H762Q	probably damaging	Het

Other mutations in Scn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Scn1a	APN	2	66335531	critical splice acceptor site	probably null
IGL00650:Scn1a	APN	2	66280793	missense	probably damaging	1.00
IGL00658:Scn1a	APN	2	66286038	missense	probably damaging	1.00
IGL00823:Scn1a	APN	2	66324935	missense	probably benign	0.04
IGL00907:Scn1a	APN	2	66327797	missense	probably damaging	1.00
IGL01339:Scn1a	APN	2	66325960	missense	probably benign	0.09
IGL01401:Scn1a	APN	2	66289111	missense	probably damaging	1.00
IGL01503:Scn1a	APN	2	66322343	missense	probably damaging	1.00
IGL01575:Scn1a	APN	2	66273236	missense	probably damaging	1.00
IGL01598:Scn1a	APN	2	66302485	missense	possibly damaging	0.63
IGL01613:Scn1a	APN	2	66285937	missense	probably damaging	1.00
IGL01796:Scn1a	APN	2	66332301	splice site	probably benign
IGL02079:Scn1a	APN	2	66323360	missense	probably benign	0.14
IGL02171:Scn1a	APN	2	66273199	missense	probably damaging	1.00
IGL02335:Scn1a	APN	2	66277661	missense	possibly damaging	0.93
IGL02406:Scn1a	APN	2	66326036	missense	possibly damaging	0.88
IGL02436:Scn1a	APN	2	66351153	missense	probably benign	0.01
IGL02507:Scn1a	APN	2	66277813	missense	probably damaging	1.00
IGL02646:Scn1a	APN	2	66299618	splice site	probably null
IGL02729:Scn1a	APN	2	66299650	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66324762	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66318077	missense	probably benign	0.00
IGL02752:Scn1a	APN	2	66331412	missense	probably damaging	1.00
IGL02815:Scn1a	APN	2	66324858	missense	probably damaging	1.00
IGL03163:Scn1a	APN	2	66318074	missense	probably benign	0.00
IGL03229:Scn1a	APN	2	66299713	missense	probably damaging	1.00
IGL03286:Scn1a	APN	2	66277576	missense	probably damaging	0.99
IGL03393:Scn1a	APN	2	66318018	missense	probably benign	0.19
BB008:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
BB018:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
PIT4791001:Scn1a	UTSW	2	66273282	missense	probably benign	0.18
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0107:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R0141:Scn1a	UTSW	2	66289062	missense	probably damaging	1.00
R0485:Scn1a	UTSW	2	66273925	missense	probably damaging	0.98
R0517:Scn1a	UTSW	2	66302407	missense	possibly damaging	0.88
R0532:Scn1a	UTSW	2	66317823	missense	probably damaging	1.00
R0746:Scn1a	UTSW	2	66351126	missense	probably benign	0.25
R0755:Scn1a	UTSW	2	66321035	missense	probably damaging	1.00
R0830:Scn1a	UTSW	2	66299784	missense	probably damaging	1.00
R0846:Scn1a	UTSW	2	66324755	missense	probably benign	0.43
R0918:Scn1a	UTSW	2	66323307	splice site	probably null
R1055:Scn1a	UTSW	2	66337996	missense	probably benign	0.08
R1432:Scn1a	UTSW	2	66322429	missense	probably damaging	1.00
R1497:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R1512:Scn1a	UTSW	2	66331285	missense	possibly damaging	0.82
R1525:Scn1a	UTSW	2	66319462	nonsense	probably null
R1567:Scn1a	UTSW	2	66273331	missense	probably damaging	1.00
R1702:Scn1a	UTSW	2	66318223	missense	probably damaging	1.00
R1744:Scn1a	UTSW	2	66322276	missense	probably benign	0.06
R1834:Scn1a	UTSW	2	66324616	missense	probably benign	0.04
R1834:Scn1a	UTSW	2	66324617	missense	probably benign	0.00
R1860:Scn1a	UTSW	2	66317982	missense	probably damaging	0.99
R1871:Scn1a	UTSW	2	66318025	missense	probably damaging	0.98
R1909:Scn1a	UTSW	2	66331352	missense	possibly damaging	0.58
R1967:Scn1a	UTSW	2	66328425	missense	probably damaging	1.00
R1976:Scn1a	UTSW	2	66331271	missense	probably benign	0.02
R2302:Scn1a	UTSW	2	66277745	missense	probably damaging	1.00
R2367:Scn1a	UTSW	2	66327679	missense	probably damaging	1.00
R2418:Scn1a	UTSW	2	66273843	missense	probably damaging	0.98
R2517:Scn1a	UTSW	2	66273832	missense	probably damaging	1.00
R2568:Scn1a	UTSW	2	66273469	missense	probably damaging	1.00
R3083:Scn1a	UTSW	2	66299637	missense	probably damaging	1.00
R3903:Scn1a	UTSW	2	66318132	missense	probably benign	0.08
R3909:Scn1a	UTSW	2	66273988	missense	probably damaging	1.00
R3916:Scn1a	UTSW	2	66277613	missense	probably damaging	1.00
R3935:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R3936:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R4043:Scn1a	UTSW	2	66326036	missense	possibly damaging	0.60
R4429:Scn1a	UTSW	2	66350985	missense	possibly damaging	0.77
R4495:Scn1a	UTSW	2	66280802	critical splice acceptor site	probably null
R4662:Scn1a	UTSW	2	66350988	missense	probably benign	0.23
R4834:Scn1a	UTSW	2	66328522	nonsense	probably null
R4873:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R4875:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R5099:Scn1a	UTSW	2	66277801	missense	probably damaging	1.00
R5255:Scn1a	UTSW	2	66277669	missense	probably damaging	0.99
R5435:Scn1a	UTSW	2	66273534	missense	probably damaging	1.00
R5449:Scn1a	UTSW	2	66321002	missense	probably damaging	0.96
R5519:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R5541:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R5556:Scn1a	UTSW	2	66324797	missense	probably benign	0.00
R5587:Scn1a	UTSW	2	66273081	missense	probably benign	0.01
R5972:Scn1a	UTSW	2	66351110	missense	possibly damaging	0.65
R5992:Scn1a	UTSW	2	66335456	missense	probably damaging	1.00
R6195:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6233:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6328:Scn1a	UTSW	2	66273316	missense	probably damaging	1.00
R6417:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6420:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6421:Scn1a	UTSW	2	66272927	missense	probably damaging	1.00
R6461:Scn1a	UTSW	2	66326122	missense	probably null	0.01
R6701:Scn1a	UTSW	2	66337960	missense	probably damaging	0.99
R6717:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R6834:Scn1a	UTSW	2	66327742	missense	probably damaging	1.00
R6918:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R6953:Scn1a	UTSW	2	66319469	missense	probably damaging	1.00
R6996:Scn1a	UTSW	2	66287731	missense	probably damaging	1.00
R7022:Scn1a	UTSW	2	66317899	missense	probably damaging	1.00
R7109:Scn1a	UTSW	2	66350942	missense	possibly damaging	0.62
R7115:Scn1a	UTSW	2	66324618	nonsense	probably null
R7239:Scn1a	UTSW	2	66277656	splice site	probably null
R7434:Scn1a	UTSW	2	66273045	missense	probably benign
R7646:Scn1a	UTSW	2	66287758	missense	possibly damaging	0.93
R7711:Scn1a	UTSW	2	66303660	missense	probably benign
R7879:Scn1a	UTSW	2	66286005	nonsense	probably null
R7931:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
R7962:Scn1a	UTSW	2	66328442	missense	probably damaging	1.00
R8025:Scn1a	UTSW	2	66318213	missense	probably benign	0.02
R8055:Scn1a	UTSW	2	66319501	missense	probably damaging	1.00
R8095:Scn1a	UTSW	2	66302465	missense	possibly damaging	0.93
R8167:Scn1a	UTSW	2	66324838	missense	probably damaging	0.98
R8339:Scn1a	UTSW	2	66286029	missense	probably damaging	1.00
R8363:Scn1a	UTSW	2	66322257	missense	probably damaging	1.00
R8516:Scn1a	UTSW	2	66326134	missense	possibly damaging	0.79
R8559:Scn1a	UTSW	2	66287733	missense	probably damaging	1.00
R8726:Scn1a	UTSW	2	66303639	missense	probably benign
R8733:Scn1a	UTSW	2	66324600	missense	probably benign
R8779:Scn1a	UTSW	2	66350913	critical splice donor site	probably benign
R8841:Scn1a	UTSW	2	66326122	missense	probably benign	0.09
R8916:Scn1a	UTSW	2	66277783	missense	probably damaging	1.00
R8919:Scn1a	UTSW	2	66337986	missense	probably benign	0.16
R9040:Scn1a	UTSW	2	66317901	missense	probably damaging	0.99
R9086:Scn1a	UTSW	2	66351014	missense	probably benign	0.01
R9176:Scn1a	UTSW	2	66273345	missense	probably damaging	1.00
R9228:Scn1a	UTSW	2	66299755	missense	probably benign	0.10
R9275:Scn1a	UTSW	2	66299682	missense	probably damaging	1.00
R9365:Scn1a	UTSW	2	66318121	missense	probably benign	0.10
R9478:Scn1a	UTSW	2	66326149	missense	probably benign	0.01
R9560:Scn1a	UTSW	2	66327787	missense	probably damaging	1.00
R9608:Scn1a	UTSW	2	66322343	missense	probably benign	0.02
R9624:Scn1a	UTSW	2	66323422	missense	probably benign
Z1176:Scn1a	UTSW	2	66326128	missense	possibly damaging	0.92
Z1177:Scn1a	UTSW	2	66324952	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTGCACTTATCTGGATTCAC -3'
(R):5'- TGCCCTGTTAGGAGCAATTC -3'

Sequencing Primer
(F):5'- TTCTTCCTAACAAAATAACAGCTGC -3'
(R):5'- GGAGCAATTCCATCCATCATGAATG -3'

Posted On

2014-10-30