Incidental Mutation 'R2291:Olfr1053'
ID244325
Institutional Source Beutler Lab
Gene Symbol Olfr1053
Ensembl Gene ENSMUSG00000075192
Gene Nameolfactory receptor 1053
SynonymsGA_x6K02T2Q125-47793414-47792471, Olfr1053-ps1, MOR187-4
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86314343-86315284 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86315180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 35 (Y35*)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
Predicted Effect probably null
Transcript: ENSMUST00000099897
AA Change: Y35*
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: Y35*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Olfr1053
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr1053 APN 2 86314944 missense probably damaging 1.00
IGL02063:Olfr1053 APN 2 86314793 missense possibly damaging 0.50
IGL02503:Olfr1053 APN 2 86314639 missense possibly damaging 0.71
IGL03342:Olfr1053 APN 2 86315235 missense possibly damaging 0.85
PIT4520001:Olfr1053 UTSW 2 86314798 missense possibly damaging 0.78
R0562:Olfr1053 UTSW 2 86314525 missense probably benign 0.00
R1026:Olfr1053 UTSW 2 86315214 missense possibly damaging 0.80
R1134:Olfr1053 UTSW 2 86315181 missense probably damaging 1.00
R1200:Olfr1053 UTSW 2 86315133 missense probably damaging 0.99
R1566:Olfr1053 UTSW 2 86314785 missense probably benign 0.01
R1588:Olfr1053 UTSW 2 86314530 missense probably damaging 1.00
R1747:Olfr1053 UTSW 2 86314867 missense probably benign 0.00
R1951:Olfr1053 UTSW 2 86315160 missense probably damaging 1.00
R1975:Olfr1053 UTSW 2 86315154 missense probably damaging 0.99
R2425:Olfr1053 UTSW 2 86314395 missense probably damaging 0.98
R5092:Olfr1053 UTSW 2 86314362 missense probably benign 0.00
R5651:Olfr1053 UTSW 2 86314440 missense probably benign 0.23
R5733:Olfr1053 UTSW 2 86315214 missense probably damaging 0.98
R5767:Olfr1053 UTSW 2 86314398 missense probably damaging 1.00
R6307:Olfr1053 UTSW 2 86315124 missense probably benign
R6720:Olfr1053 UTSW 2 86315065 missense probably damaging 0.99
R7067:Olfr1053 UTSW 2 86314567 missense probably damaging 1.00
R7289:Olfr1053 UTSW 2 86315025 missense probably benign 0.00
R7604:Olfr1053 UTSW 2 86314900 missense probably damaging 1.00
R7773:Olfr1053 UTSW 2 86314690 missense probably benign 0.01
R8345:Olfr1053 UTSW 2 86315107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGTAGCACATTCACAG -3'
(R):5'- CCAACAAGATGAAGTTGCAGTC -3'

Sequencing Primer
(F):5'- CACATTCACAGAAAGAAATGGTTTTG -3'
(R):5'- GTTGCAGTCTAAAAACAAAGCTC -3'
Posted On2014-10-30