Mutagenetix > Incidental Mutations

Incidental Mutation 'R2291:Tril'

244342

Institutional Source

Beutler Lab

Gene Symbol

Tril

Ensembl Gene

ENSMUSG00000043496

Gene Name

TLR4 interactor with leucine-rich repeats

Synonyms

MMRRC Submission

040290-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R2291 (G1)

Quality Score

111

Status

Not validated

Chromosome

Chromosomal Location

53815468-53820830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 53818027 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 737 (R737S)

Ref Sequence

ENSEMBL: ENSMUSP00000116056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127748]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104970

Predicted Effect

probably damaging
Transcript: ENSMUST00000127748
AA Change: R737S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116056
Gene: ENSMUSG00000043496
AA Change: R737S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	26	58	1.91e-1	SMART
LRR_TYP	82	105	3.49e-5	SMART
LRR_TYP	106	129	2.91e-2	SMART
LRR	130	153	9.96e-1	SMART
LRR	154	177	2.49e-1	SMART
LRR_TYP	178	201	1.67e-2	SMART
LRR	202	227	1.09e2	SMART
LRR_TYP	228	251	4.47e-3	SMART
LRR_TYP	252	275	1.84e-4	SMART
LRR	276	299	7.05e-1	SMART
LRR_TYP	300	323	1.3e-4	SMART
LRR	325	347	1.12e1	SMART
LRRCT	359	415	1.02e-2	SMART
low complexity region	448	465	N/A	INTRINSIC
low complexity region	488	506	N/A	INTRINSIC
low complexity region	554	569	N/A	INTRINSIC
Blast:FN3	582	667	8e-34	BLAST
transmembrane domain	695	717	N/A	INTRINSIC
low complexity region	720	732	N/A	INTRINSIC
low complexity region	788	796	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204648

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TRIL is a component of the TLR4 (MIM 603030) complex and is induced in a number of cell types by lipopolysaccharide (LPS) (Carpenter et al., 2009 [PubMed 19710467]).[supplied by OMIM, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,413,801	I247N	probably damaging	Het
Afdn	A	G	17: 13,888,891	K1559E	probably damaging	Het
Ankhd1	C	T	18: 36,644,333	T1523I	probably benign	Het
Apc	T	A	18: 34,312,491	N795K	probably benign	Het
Arhgap26	G	T	18: 39,357,698		probably benign	Het
Atm	C	T	9: 53,490,909		probably null	Het
Atp1a4	T	C	1: 172,244,906	N394D	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Cacna1d	G	T	14: 30,042,342	R2078S	probably damaging	Het
Cacna1e	T	C	1: 154,403,683	D1720G	probably damaging	Het
Camk2a	T	A	18: 60,963,959	V38E	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccr7	G	A	11: 99,145,335	R254C	probably damaging	Het
Celf5	C	T	10: 81,467,047	G267D	probably damaging	Het
Cfap65	G	A	1: 74,926,475	P459S	probably damaging	Het
Chd1l	T	C	3: 97,591,283	K267E	probably damaging	Het
Chl1	T	A	6: 103,715,393	Y331N	probably damaging	Het
Cltc	G	A	11: 86,733,622	T158I	probably benign	Het
Col16a1	T	A	4: 130,067,040	D430E	unknown	Het
Cspg4	T	C	9: 56,892,743	V1597A	probably damaging	Het
Cstf2t	T	A	19: 31,084,864	L600H	probably benign	Het
Cyp27b1	T	C	10: 127,048,294	V5A	possibly damaging	Het
Depdc5	C	A	5: 32,979,402	Q1339K	probably damaging	Het
Diaph3	G	T	14: 86,966,446	P592Q	probably damaging	Het
Epha8	T	C	4: 136,933,347	M687V	probably damaging	Het
Fhod1	T	A	8: 105,336,964		probably benign	Het
Gls2	C	A	10: 128,207,610	S73*	probably null	Het
Gm3604	T	A	13: 62,371,843	M33L	probably damaging	Het
Gpr39	A	G	1: 125,677,541	T69A	probably benign	Het
Hal	T	C	10: 93,503,536	F496L	probably damaging	Het
Hipk1	T	C	3: 103,761,610	E490G	probably damaging	Het
Ints7	T	G	1: 191,606,203		probably null	Het
Itpr3	A	G	17: 27,113,579	E1799G	possibly damaging	Het
Kif11	T	A	19: 37,407,003	M570K	probably benign	Het
Kif18b	G	T	11: 102,908,270	Q702K	probably damaging	Het
Kif19a	A	G	11: 114,790,193	T247A	probably damaging	Het
Lama3	A	G	18: 12,525,079	E360G	probably damaging	Het
Loxl3	G	T	6: 83,037,488	A126S	probably benign	Het
Mc5r	C	T	18: 68,339,364	R265W	probably damaging	Het
Mpl	A	G	4: 118,449,000	V340A	probably benign	Het
Mrpl13	G	T	15: 55,548,219	H56Q	probably damaging	Het
Msr1	T	C	8: 39,624,222	T116A	probably benign	Het
N4bp3	T	C	11: 51,646,103	K48E	probably damaging	Het
Naaladl1	A	G	19: 6,106,195	T104A	probably benign	Het
Neu1	C	T	17: 34,932,766	R179W	probably damaging	Het
Olfr1053	A	T	2: 86,315,180	Y35*	probably null	Het
Olfr975	T	C	9: 39,950,334	T146A	probably benign	Het
Osbp	G	T	19: 11,973,834	E248*	probably null	Het
Otx1	T	A	11: 21,996,634		probably benign	Het
Parp4	A	T	14: 56,613,817	Q759L	probably damaging	Het
Pax6	A	C	2: 105,685,883	S169R	probably benign	Het
Pigg	T	G	5: 108,332,917	I389M	probably damaging	Het
Pla2g4a	C	A	1: 149,901,189	V59F	probably damaging	Het
Plcb4	A	T	2: 135,939,983	Q241H	probably benign	Het
Plpp6	A	G	19: 28,964,320	D107G	probably damaging	Het
Ppp6r2	T	A	15: 89,275,487	L459Q	probably damaging	Het
Prss55	A	T	14: 64,075,722	W238R	probably damaging	Het
Rgl1	C	T	1: 152,536,281	E446K	probably damaging	Het
Ric3	C	T	7: 109,038,883	G221D	probably damaging	Het
Rnf167	T	C	11: 70,649,303	F83S	probably damaging	Het
Ryr1	C	T	7: 29,098,777	V947M	probably damaging	Het
Scn1a	A	G	2: 66,288,968	L1397P	probably benign	Het
Sh3bp1	T	A	15: 78,918,319	V251E	possibly damaging	Het
Slc25a10	A	T	11: 120,497,074	I198L	probably benign	Het
Smoc2	A	T	17: 14,368,971	N234I	possibly damaging	Het
Spdl1	T	A	11: 34,819,309	K382*	probably null	Het
Ssrp1	G	A	2: 85,042,316		probably null	Het
Triqk	T	A	4: 12,974,817		probably null	Het
Ttc19	T	C	11: 62,283,693	Y128H	probably damaging	Het
Vmn1r15	T	C	6: 57,258,692	S182P	possibly damaging	Het
Vmn1r226	A	G	17: 20,688,213	I236V	probably damaging	Het
Vmn2r120	A	C	17: 57,509,479	N625K	probably damaging	Het
Vmn2r78	T	C	7: 86,920,154	I85T	probably damaging	Het
Wdr60	A	T	12: 116,229,571		probably null	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt7a	C	T	6: 91,394,486	V165I	probably benign	Het
Zbtb40	A	T	4: 136,985,017	Y1127N	possibly damaging	Het
Zfyve1	A	T	12: 83,547,931	H762Q	probably damaging	Het

Other mutations in Tril

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Tril	APN	6	53819038	missense	probably damaging	1.00
IGL03399:Tril	APN	6	53820057	missense	probably benign	0.01
R0036:Tril	UTSW	6	53818633	missense	probably benign
R0099:Tril	UTSW	6	53818363	missense	probably damaging	0.99
R0448:Tril	UTSW	6	53817808	makesense	probably null
R0759:Tril	UTSW	6	53818027	missense	probably damaging	0.98
R1296:Tril	UTSW	6	53818027	missense	probably damaging	0.98
R1472:Tril	UTSW	6	53818027	missense	probably damaging	0.98
R1888:Tril	UTSW	6	53819592	missense	probably damaging	1.00
R1888:Tril	UTSW	6	53819592	missense	probably damaging	1.00
R2108:Tril	UTSW	6	53819083	missense	probably damaging	1.00
R2290:Tril	UTSW	6	53818027	missense	probably damaging	0.98
R2367:Tril	UTSW	6	53819166	missense	probably damaging	1.00
R4021:Tril	UTSW	6	53819019	missense	probably damaging	1.00
R4753:Tril	UTSW	6	53819713	missense	probably damaging	1.00
R4755:Tril	UTSW	6	53818464	missense	probably damaging	0.99
R4981:Tril	UTSW	6	53818920	missense	probably benign	0.10
R5468:Tril	UTSW	6	53819647	missense	probably damaging	1.00
R5653:Tril	UTSW	6	53817985	missense	probably benign	0.32
R6434:Tril	UTSW	6	53818508	missense	probably damaging	1.00
R6724:Tril	UTSW	6	53819574	missense	possibly damaging	0.94
R7401:Tril	UTSW	6	53818281	missense	possibly damaging	0.54
R7582:Tril	UTSW	6	53818936	missense	probably benign
R8339:Tril	UTSW	6	53817933	missense	possibly damaging	0.84
R8544:Tril	UTSW	6	53819310	missense	possibly damaging	0.93
R8721:Tril	UTSW	6	53820198	missense	probably benign	0.02
R8879:Tril	UTSW	6	53819584	missense	probably damaging	0.99
R8904:Tril	UTSW	6	53820217	missense	possibly damaging	0.51
Z1088:Tril	UTSW	6	53818920	missense	probably benign	0.45
Z1177:Tril	UTSW	6	53819644	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTGCCTAGTCAGCGAATCTTTG -3'
(R):5'- GTTAGTAACCCTGCCAGAGG -3'

Sequencing Primer
(F):5'- CCTAGTCAGCGAATCTTTGCAAGAG -3'
(R):5'- CCAGAGGCAGGAGGTCG -3'

Posted On

2014-10-30