Mutagenetix > Incidental Mutations

Incidental Mutation 'R2291:Chl1'

244346

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

040290-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

R2291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103715393 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 331 (Y331N)

Ref Sequence

ENSEMBL: ENSMUSP00000144739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066905
AA Change: Y1112N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: Y1112N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203830
AA Change: Y1112N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: Y1112N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203912
AA Change: Y1074N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: Y1074N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000205098
AA Change: Y331N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077
AA Change: Y331N

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,413,801	I247N	probably damaging	Het
Afdn	A	G	17: 13,888,891	K1559E	probably damaging	Het
Ankhd1	C	T	18: 36,644,333	T1523I	probably benign	Het
Apc	T	A	18: 34,312,491	N795K	probably benign	Het
Arhgap26	G	T	18: 39,357,698		probably benign	Het
Atm	C	T	9: 53,490,909		probably null	Het
Atp1a4	T	C	1: 172,244,906	N394D	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Cacna1d	G	T	14: 30,042,342	R2078S	probably damaging	Het
Cacna1e	T	C	1: 154,403,683	D1720G	probably damaging	Het
Camk2a	T	A	18: 60,963,959	V38E	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccr7	G	A	11: 99,145,335	R254C	probably damaging	Het
Celf5	C	T	10: 81,467,047	G267D	probably damaging	Het
Cfap65	G	A	1: 74,926,475	P459S	probably damaging	Het
Chd1l	T	C	3: 97,591,283	K267E	probably damaging	Het
Cltc	G	A	11: 86,733,622	T158I	probably benign	Het
Col16a1	T	A	4: 130,067,040	D430E	unknown	Het
Cspg4	T	C	9: 56,892,743	V1597A	probably damaging	Het
Cstf2t	T	A	19: 31,084,864	L600H	probably benign	Het
Cyp27b1	T	C	10: 127,048,294	V5A	possibly damaging	Het
Depdc5	C	A	5: 32,979,402	Q1339K	probably damaging	Het
Diaph3	G	T	14: 86,966,446	P592Q	probably damaging	Het
Epha8	T	C	4: 136,933,347	M687V	probably damaging	Het
Fhod1	T	A	8: 105,336,964		probably benign	Het
Gls2	C	A	10: 128,207,610	S73*	probably null	Het
Gm3604	T	A	13: 62,371,843	M33L	probably damaging	Het
Gpr39	A	G	1: 125,677,541	T69A	probably benign	Het
Hal	T	C	10: 93,503,536	F496L	probably damaging	Het
Hipk1	T	C	3: 103,761,610	E490G	probably damaging	Het
Ints7	T	G	1: 191,606,203		probably null	Het
Itpr3	A	G	17: 27,113,579	E1799G	possibly damaging	Het
Kif11	T	A	19: 37,407,003	M570K	probably benign	Het
Kif18b	G	T	11: 102,908,270	Q702K	probably damaging	Het
Kif19a	A	G	11: 114,790,193	T247A	probably damaging	Het
Lama3	A	G	18: 12,525,079	E360G	probably damaging	Het
Loxl3	G	T	6: 83,037,488	A126S	probably benign	Het
Mc5r	C	T	18: 68,339,364	R265W	probably damaging	Het
Mpl	A	G	4: 118,449,000	V340A	probably benign	Het
Mrpl13	G	T	15: 55,548,219	H56Q	probably damaging	Het
Msr1	T	C	8: 39,624,222	T116A	probably benign	Het
N4bp3	T	C	11: 51,646,103	K48E	probably damaging	Het
Naaladl1	A	G	19: 6,106,195	T104A	probably benign	Het
Neu1	C	T	17: 34,932,766	R179W	probably damaging	Het
Olfr1053	A	T	2: 86,315,180	Y35*	probably null	Het
Olfr975	T	C	9: 39,950,334	T146A	probably benign	Het
Osbp	G	T	19: 11,973,834	E248*	probably null	Het
Otx1	T	A	11: 21,996,634		probably benign	Het
Parp4	A	T	14: 56,613,817	Q759L	probably damaging	Het
Pax6	A	C	2: 105,685,883	S169R	probably benign	Het
Pigg	T	G	5: 108,332,917	I389M	probably damaging	Het
Pla2g4a	C	A	1: 149,901,189	V59F	probably damaging	Het
Plcb4	A	T	2: 135,939,983	Q241H	probably benign	Het
Plpp6	A	G	19: 28,964,320	D107G	probably damaging	Het
Ppp6r2	T	A	15: 89,275,487	L459Q	probably damaging	Het
Prss55	A	T	14: 64,075,722	W238R	probably damaging	Het
Rgl1	C	T	1: 152,536,281	E446K	probably damaging	Het
Ric3	C	T	7: 109,038,883	G221D	probably damaging	Het
Rnf167	T	C	11: 70,649,303	F83S	probably damaging	Het
Ryr1	C	T	7: 29,098,777	V947M	probably damaging	Het
Scn1a	A	G	2: 66,288,968	L1397P	probably benign	Het
Sh3bp1	T	A	15: 78,918,319	V251E	possibly damaging	Het
Slc25a10	A	T	11: 120,497,074	I198L	probably benign	Het
Smoc2	A	T	17: 14,368,971	N234I	possibly damaging	Het
Spdl1	T	A	11: 34,819,309	K382*	probably null	Het
Ssrp1	G	A	2: 85,042,316		probably null	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Triqk	T	A	4: 12,974,817		probably null	Het
Ttc19	T	C	11: 62,283,693	Y128H	probably damaging	Het
Vmn1r15	T	C	6: 57,258,692	S182P	possibly damaging	Het
Vmn1r226	A	G	17: 20,688,213	I236V	probably damaging	Het
Vmn2r120	A	C	17: 57,509,479	N625K	probably damaging	Het
Vmn2r78	T	C	7: 86,920,154	I85T	probably damaging	Het
Wdr60	A	T	12: 116,229,571		probably null	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt7a	C	T	6: 91,394,486	V165I	probably benign	Het
Zbtb40	A	T	4: 136,985,017	Y1127N	possibly damaging	Het
Zfyve1	A	T	12: 83,547,931	H762Q	probably damaging	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	utr 5 prime	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CATGGACTGATTCTAGAGGTCAACG -3'
(R):5'- TGTAGTCCCTTTGGCATTCTAAG -3'

Sequencing Primer
(F):5'- CTAGAGGTCAACGTTGTGCC -3'
(R):5'- CTACCTAGTGAGTTTTAGGACAGCC -3'

Posted On

2014-10-30