Incidental Mutation 'R2291:Ric3'
ID244352
Institutional Source Beutler Lab
Gene Symbol Ric3
Ensembl Gene ENSMUSG00000048330
Gene NameRIC3 acetylcholine receptor chaperone
Synonyms
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109034312-109083331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109038883 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 221 (G221D)
Ref Sequence ENSEMBL: ENSMUSP00000112788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000055993] [ENSMUST00000120876] [ENSMUST00000147580]
Predicted Effect probably benign
Transcript: ENSMUST00000033341
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055993
AA Change: G222D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056990
Gene: ENSMUSG00000048330
AA Change: G222D

DomainStartEndE-ValueType
Pfam:RIC3 15 165 1.2e-38 PFAM
low complexity region 256 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120876
AA Change: G221D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112788
Gene: ENSMUSG00000048330
AA Change: G221D

DomainStartEndE-ValueType
Pfam:RIC3 15 165 3.9e-52 PFAM
low complexity region 255 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147580
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Ric3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ric3 APN 7 109054412 missense probably damaging 1.00
IGL00942:Ric3 APN 7 109054413 missense probably damaging 1.00
IGL02318:Ric3 APN 7 109048080 missense probably damaging 1.00
IGL02868:Ric3 APN 7 109054419 missense probably damaging 1.00
IGL03012:Ric3 APN 7 109038718 missense probably benign
R0842:Ric3 UTSW 7 109038880 missense probably damaging 1.00
R2912:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R2913:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R3690:Ric3 UTSW 7 109038610 missense possibly damaging 0.89
R4587:Ric3 UTSW 7 109054363 critical splice donor site probably null
R5039:Ric3 UTSW 7 109038723 missense probably benign
R5636:Ric3 UTSW 7 109038820 missense probably damaging 1.00
R6738:Ric3 UTSW 7 109048062 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGTTTGGGATCACACGG -3'
(R):5'- GCCAGACTGCTCAGAATTTG -3'

Sequencing Primer
(F):5'- CACGGGGCAACAGAATTATCTTTC -3'
(R):5'- CCAGACTGCTCAGAATTTGTTCAAG -3'
Posted On2014-10-30