Incidental Mutation 'R2291:Msr1'
ID244353
Institutional Source Beutler Lab
Gene Symbol Msr1
Ensembl Gene ENSMUSG00000025044
Gene Namemacrophage scavenger receptor 1
SynonymsSR-AI, MSR-A, SR-AII, Scara1, Scvr, MRS-A
MMRRC Submission 040290-MU
Accession Numbers

Ncbi RefSeq: NM_001113326; MGI:98257

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location39581685-39642673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39624222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 116 (T116A)
Ref Sequence ENSEMBL: ENSMUSP00000132535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026021] [ENSMUST00000170091] [ENSMUST00000210525]
Predicted Effect probably benign
Transcript: ENSMUST00000026021
AA Change: T116A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: T116A

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 1.5e-28 PFAM
coiled coil region 209 259 N/A INTRINSIC
Pfam:Collagen 275 330 3.2e-11 PFAM
Pfam:Collagen 295 353 4.8e-10 PFAM
SR 357 457 5.68e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170091
AA Change: T116A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132535
Gene: ENSMUSG00000025044
AA Change: T116A

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 6.6e-34 PFAM
Pfam:Collagen 275 330 1.9e-10 PFAM
Pfam:Collagen 292 352 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210681
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Msr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Msr1 APN 8 39611673 missense probably benign 0.42
IGL02047:Msr1 APN 8 39623960 missense probably benign 0.03
IGL02218:Msr1 APN 8 39589316 missense possibly damaging 0.51
IGL02347:Msr1 APN 8 39632737 missense probably damaging 1.00
IGL02546:Msr1 APN 8 39615747 missense probably benign
IGL02707:Msr1 APN 8 39632829 splice site probably benign
IGL03340:Msr1 APN 8 39620007 missense possibly damaging 0.53
R0349:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R0378:Msr1 UTSW 8 39589382 missense possibly damaging 0.92
R0633:Msr1 UTSW 8 39620000 missense probably damaging 0.99
R1386:Msr1 UTSW 8 39589293 nonsense probably null
R1807:Msr1 UTSW 8 39619907 missense probably benign 0.33
R2039:Msr1 UTSW 8 39589377 missense probably damaging 1.00
R2174:Msr1 UTSW 8 39631340 missense probably damaging 1.00
R3983:Msr1 UTSW 8 39620018 missense possibly damaging 0.89
R4807:Msr1 UTSW 8 39642627 start gained probably benign
R4921:Msr1 UTSW 8 39624251 missense possibly damaging 0.72
R5055:Msr1 UTSW 8 39623956 missense possibly damaging 0.78
R5567:Msr1 UTSW 8 39611719 missense probably benign
R5570:Msr1 UTSW 8 39611719 missense probably benign
R5871:Msr1 UTSW 8 39611652 missense probably damaging 0.97
R5914:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R6141:Msr1 UTSW 8 39631319 missense probably damaging 1.00
R6429:Msr1 UTSW 8 39615817 missense probably damaging 0.99
R6519:Msr1 UTSW 8 39624221 missense probably benign
R6527:Msr1 UTSW 8 39624233 missense possibly damaging 0.72
R6842:Msr1 UTSW 8 39632825 missense probably benign 0.01
R7006:Msr1 UTSW 8 39589382 missense probably damaging 0.99
R7047:Msr1 UTSW 8 39642616 missense possibly damaging 0.92
R7135:Msr1 UTSW 8 39589424 missense possibly damaging 0.93
R7552:Msr1 UTSW 8 39623962 missense probably benign 0.19
R7837:Msr1 UTSW 8 39581832 missense probably damaging 0.99
R7920:Msr1 UTSW 8 39581832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGGAGATTGCATCCAGTG -3'
(R):5'- TCAATGGGTGGGATTCAAAGAC -3'

Sequencing Primer
(F):5'- GGAGATTGCATCCAGTGAATTCCC -3'
(R):5'- TTCAAAGACATAGGGATGATGAGCAC -3'
Posted On2014-10-30