Incidental Mutation 'R2291:Or10d5'
ID 244356
Institutional Source Beutler Lab
Gene Symbol Or10d5
Ensembl Gene ENSMUSG00000043331
Gene Name olfactory receptor family 10 subfamily D member 5
Synonyms MOR224-2, GA_x6K02T2PVTD-33651220-33650288, Olfr975
MMRRC Submission 040290-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R2291 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39861133-39862065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39861630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 146 (T146A)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000216647] [ENSMUST00000217630]
AlphaFold Q8VG91
Predicted Effect probably benign
Transcript: ENSMUST00000054067
AA Change: T146A

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: T146A

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000216647
AA Change: T146A

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,207,450 (GRCm39) I247N probably damaging Het
Afdn A G 17: 14,109,153 (GRCm39) K1559E probably damaging Het
Ankhd1 C T 18: 36,777,386 (GRCm39) T1523I probably benign Het
Apc T A 18: 34,445,544 (GRCm39) N795K probably benign Het
Arhgap26 G T 18: 39,490,751 (GRCm39) probably benign Het
Atm C T 9: 53,402,209 (GRCm39) probably null Het
Atp1a4 T C 1: 172,072,473 (GRCm39) N394D probably damaging Het
Brinp3 T A 1: 146,776,812 (GRCm39) S420T possibly damaging Het
Cacna1d G T 14: 29,764,299 (GRCm39) R2078S probably damaging Het
Cacna1e T C 1: 154,279,429 (GRCm39) D1720G probably damaging Het
Camk2a T A 18: 61,097,031 (GRCm39) V38E probably damaging Het
Camk4 G A 18: 33,240,996 (GRCm39) probably null Het
Ccr7 G A 11: 99,036,161 (GRCm39) R254C probably damaging Het
Celf5 C T 10: 81,302,881 (GRCm39) G267D probably damaging Het
Cfap65 G A 1: 74,965,634 (GRCm39) P459S probably damaging Het
Chd1l T C 3: 97,498,599 (GRCm39) K267E probably damaging Het
Chl1 T A 6: 103,692,354 (GRCm39) Y331N probably damaging Het
Cltc G A 11: 86,624,448 (GRCm39) T158I probably benign Het
Col16a1 T A 4: 129,960,833 (GRCm39) D430E unknown Het
Cspg4 T C 9: 56,800,027 (GRCm39) V1597A probably damaging Het
Cstf2t T A 19: 31,062,264 (GRCm39) L600H probably benign Het
Cyp27b1 T C 10: 126,884,163 (GRCm39) V5A possibly damaging Het
Depdc5 C A 5: 33,136,746 (GRCm39) Q1339K probably damaging Het
Diaph3 G T 14: 87,203,882 (GRCm39) P592Q probably damaging Het
Dync2i1 A T 12: 116,193,191 (GRCm39) probably null Het
Epha8 T C 4: 136,660,658 (GRCm39) M687V probably damaging Het
Fhod1 T A 8: 106,063,596 (GRCm39) probably benign Het
Gls2 C A 10: 128,043,479 (GRCm39) S73* probably null Het
Gm3604 T A 13: 62,519,657 (GRCm39) M33L probably damaging Het
Gpr39 A G 1: 125,605,278 (GRCm39) T69A probably benign Het
Hal T C 10: 93,339,398 (GRCm39) F496L probably damaging Het
Hipk1 T C 3: 103,668,926 (GRCm39) E490G probably damaging Het
Ints7 T G 1: 191,338,315 (GRCm39) probably null Het
Itpr3 A G 17: 27,332,553 (GRCm39) E1799G possibly damaging Het
Kif11 T A 19: 37,395,451 (GRCm39) M570K probably benign Het
Kif18b G T 11: 102,799,096 (GRCm39) Q702K probably damaging Het
Kif19a A G 11: 114,681,019 (GRCm39) T247A probably damaging Het
Lama3 A G 18: 12,658,136 (GRCm39) E360G probably damaging Het
Loxl3 G T 6: 83,014,469 (GRCm39) A126S probably benign Het
Mc5r C T 18: 68,472,435 (GRCm39) R265W probably damaging Het
Mpl A G 4: 118,306,197 (GRCm39) V340A probably benign Het
Mrpl13 G T 15: 55,411,615 (GRCm39) H56Q probably damaging Het
Msr1 T C 8: 40,077,263 (GRCm39) T116A probably benign Het
N4bp3 T C 11: 51,536,930 (GRCm39) K48E probably damaging Het
Naaladl1 A G 19: 6,156,225 (GRCm39) T104A probably benign Het
Neu1 C T 17: 35,151,742 (GRCm39) R179W probably damaging Het
Or8k21 A T 2: 86,145,524 (GRCm39) Y35* probably null Het
Osbp G T 19: 11,951,198 (GRCm39) E248* probably null Het
Otx1 T A 11: 21,946,634 (GRCm39) probably benign Het
Parp4 A T 14: 56,851,274 (GRCm39) Q759L probably damaging Het
Pax6 A C 2: 105,516,228 (GRCm39) S169R probably benign Het
Pigg T G 5: 108,480,783 (GRCm39) I389M probably damaging Het
Pla2g4a C A 1: 149,776,940 (GRCm39) V59F probably damaging Het
Plcb4 A T 2: 135,781,903 (GRCm39) Q241H probably benign Het
Plpp6 A G 19: 28,941,720 (GRCm39) D107G probably damaging Het
Ppp6r2 T A 15: 89,159,690 (GRCm39) L459Q probably damaging Het
Prss55 A T 14: 64,313,171 (GRCm39) W238R probably damaging Het
Rgl1 C T 1: 152,412,032 (GRCm39) E446K probably damaging Het
Ric3 C T 7: 108,638,090 (GRCm39) G221D probably damaging Het
Rnf167 T C 11: 70,540,129 (GRCm39) F83S probably damaging Het
Ryr1 C T 7: 28,798,202 (GRCm39) V947M probably damaging Het
Scn1a A G 2: 66,119,312 (GRCm39) L1397P probably benign Het
Sh3bp1 T A 15: 78,802,519 (GRCm39) V251E possibly damaging Het
Slc25a10 A T 11: 120,387,900 (GRCm39) I198L probably benign Het
Smoc2 A T 17: 14,589,233 (GRCm39) N234I possibly damaging Het
Spdl1 T A 11: 34,710,136 (GRCm39) K382* probably null Het
Ssrp1 G A 2: 84,872,660 (GRCm39) probably null Het
Tril G T 6: 53,795,012 (GRCm39) R737S probably damaging Het
Triqk T A 4: 12,974,817 (GRCm39) probably null Het
Ttc19 T C 11: 62,174,519 (GRCm39) Y128H probably damaging Het
Vmn1r15 T C 6: 57,235,677 (GRCm39) S182P possibly damaging Het
Vmn1r226 A G 17: 20,908,475 (GRCm39) I236V probably damaging Het
Vmn2r120 A C 17: 57,816,479 (GRCm39) N625K probably damaging Het
Vmn2r78 T C 7: 86,569,362 (GRCm39) I85T probably damaging Het
Whamm C T 7: 81,241,519 (GRCm39) R277* probably null Het
Wnt7a C T 6: 91,371,468 (GRCm39) V165I probably benign Het
Zbtb40 A T 4: 136,712,328 (GRCm39) Y1127N possibly damaging Het
Zfyve1 A T 12: 83,594,705 (GRCm39) H762Q probably damaging Het
Other mutations in Or10d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Or10d5 APN 9 39,861,284 (GRCm39) missense probably benign 0.01
IGL01537:Or10d5 APN 9 39,861,921 (GRCm39) missense probably benign 0.00
IGL01963:Or10d5 APN 9 39,861,536 (GRCm39) missense probably damaging 1.00
IGL02400:Or10d5 APN 9 39,861,635 (GRCm39) missense probably benign
IGL03115:Or10d5 APN 9 39,862,040 (GRCm39) missense probably damaging 0.98
IGL03226:Or10d5 APN 9 39,861,719 (GRCm39) splice site probably null
R0088:Or10d5 UTSW 9 39,861,671 (GRCm39) missense probably benign 0.03
R0212:Or10d5 UTSW 9 39,861,236 (GRCm39) missense probably benign 0.44
R1668:Or10d5 UTSW 9 39,861,465 (GRCm39) missense possibly damaging 0.94
R1878:Or10d5 UTSW 9 39,862,053 (GRCm39) missense probably benign 0.35
R2225:Or10d5 UTSW 9 39,861,833 (GRCm39) missense possibly damaging 0.84
R2420:Or10d5 UTSW 9 39,861,824 (GRCm39) missense possibly damaging 0.47
R2421:Or10d5 UTSW 9 39,861,824 (GRCm39) missense possibly damaging 0.47
R2422:Or10d5 UTSW 9 39,861,824 (GRCm39) missense possibly damaging 0.47
R2425:Or10d5 UTSW 9 39,861,137 (GRCm39) missense probably null 0.25
R2918:Or10d5 UTSW 9 39,861,660 (GRCm39) missense probably benign
R4536:Or10d5 UTSW 9 39,861,731 (GRCm39) missense probably damaging 1.00
R4709:Or10d5 UTSW 9 39,861,165 (GRCm39) missense probably damaging 0.97
R4831:Or10d5 UTSW 9 39,861,408 (GRCm39) missense probably benign 0.01
R4921:Or10d5 UTSW 9 39,861,521 (GRCm39) missense probably damaging 0.98
R5113:Or10d5 UTSW 9 39,861,221 (GRCm39) missense probably damaging 0.99
R5141:Or10d5 UTSW 9 39,861,170 (GRCm39) missense probably benign 0.07
R5195:Or10d5 UTSW 9 39,861,975 (GRCm39) missense probably benign
R5213:Or10d5 UTSW 9 39,861,389 (GRCm39) missense probably damaging 0.99
R5568:Or10d5 UTSW 9 39,861,983 (GRCm39) missense probably benign 0.05
R6993:Or10d5 UTSW 9 39,861,933 (GRCm39) missense probably benign
R7080:Or10d5 UTSW 9 39,861,444 (GRCm39) missense probably damaging 1.00
R7436:Or10d5 UTSW 9 39,861,349 (GRCm39) nonsense probably null
R8178:Or10d5 UTSW 9 39,861,708 (GRCm39) missense probably benign 0.05
R8179:Or10d5 UTSW 9 39,861,708 (GRCm39) missense probably benign 0.05
R8382:Or10d5 UTSW 9 39,861,455 (GRCm39) missense probably benign 0.21
R8402:Or10d5 UTSW 9 39,861,713 (GRCm39) missense probably benign 0.39
R8511:Or10d5 UTSW 9 39,861,455 (GRCm39) missense probably benign 0.21
R8798:Or10d5 UTSW 9 39,862,013 (GRCm39) missense probably benign 0.40
R9068:Or10d5 UTSW 9 39,862,087 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCGACAAGACCTACGTTGATG -3'
(R):5'- CCCTTCTGTGAGTTCCCCAAAG -3'

Sequencing Primer
(F):5'- GAAACTTACAGCTTGTGCCAG -3'
(R):5'- GTGAGTTCCCCAAAGATGATGCTC -3'
Posted On 2014-10-30