Mutagenetix > Incidental Mutation

Incidental Mutation 'R2291:Cspg4'

244358

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

MMRRC Submission

040290-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56892743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1597 (V1597A)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

AlphaFold

Q8VHY0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035661
AA Change: V1597A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: V1597A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217052

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,413,801	I247N	probably damaging	Het
Afdn	A	G	17: 13,888,891	K1559E	probably damaging	Het
Ankhd1	C	T	18: 36,644,333	T1523I	probably benign	Het
Apc	T	A	18: 34,312,491	N795K	probably benign	Het
Arhgap26	G	T	18: 39,357,698		probably benign	Het
Atm	C	T	9: 53,490,909		probably null	Het
Atp1a4	T	C	1: 172,244,906	N394D	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Cacna1d	G	T	14: 30,042,342	R2078S	probably damaging	Het
Cacna1e	T	C	1: 154,403,683	D1720G	probably damaging	Het
Camk2a	T	A	18: 60,963,959	V38E	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccr7	G	A	11: 99,145,335	R254C	probably damaging	Het
Celf5	C	T	10: 81,467,047	G267D	probably damaging	Het
Cfap65	G	A	1: 74,926,475	P459S	probably damaging	Het
Chd1l	T	C	3: 97,591,283	K267E	probably damaging	Het
Chl1	T	A	6: 103,715,393	Y331N	probably damaging	Het
Cltc	G	A	11: 86,733,622	T158I	probably benign	Het
Col16a1	T	A	4: 130,067,040	D430E	unknown	Het
Cstf2t	T	A	19: 31,084,864	L600H	probably benign	Het
Cyp27b1	T	C	10: 127,048,294	V5A	possibly damaging	Het
Depdc5	C	A	5: 32,979,402	Q1339K	probably damaging	Het
Diaph3	G	T	14: 86,966,446	P592Q	probably damaging	Het
Epha8	T	C	4: 136,933,347	M687V	probably damaging	Het
Fhod1	T	A	8: 105,336,964		probably benign	Het
Gls2	C	A	10: 128,207,610	S73*	probably null	Het
Gm3604	T	A	13: 62,371,843	M33L	probably damaging	Het
Gpr39	A	G	1: 125,677,541	T69A	probably benign	Het
Hal	T	C	10: 93,503,536	F496L	probably damaging	Het
Hipk1	T	C	3: 103,761,610	E490G	probably damaging	Het
Ints7	T	G	1: 191,606,203		probably null	Het
Itpr3	A	G	17: 27,113,579	E1799G	possibly damaging	Het
Kif11	T	A	19: 37,407,003	M570K	probably benign	Het
Kif18b	G	T	11: 102,908,270	Q702K	probably damaging	Het
Kif19a	A	G	11: 114,790,193	T247A	probably damaging	Het
Lama3	A	G	18: 12,525,079	E360G	probably damaging	Het
Loxl3	G	T	6: 83,037,488	A126S	probably benign	Het
Mc5r	C	T	18: 68,339,364	R265W	probably damaging	Het
Mpl	A	G	4: 118,449,000	V340A	probably benign	Het
Mrpl13	G	T	15: 55,548,219	H56Q	probably damaging	Het
Msr1	T	C	8: 39,624,222	T116A	probably benign	Het
N4bp3	T	C	11: 51,646,103	K48E	probably damaging	Het
Naaladl1	A	G	19: 6,106,195	T104A	probably benign	Het
Neu1	C	T	17: 34,932,766	R179W	probably damaging	Het
Olfr1053	A	T	2: 86,315,180	Y35*	probably null	Het
Olfr975	T	C	9: 39,950,334	T146A	probably benign	Het
Osbp	G	T	19: 11,973,834	E248*	probably null	Het
Otx1	T	A	11: 21,996,634		probably benign	Het
Parp4	A	T	14: 56,613,817	Q759L	probably damaging	Het
Pax6	A	C	2: 105,685,883	S169R	probably benign	Het
Pigg	T	G	5: 108,332,917	I389M	probably damaging	Het
Pla2g4a	C	A	1: 149,901,189	V59F	probably damaging	Het
Plcb4	A	T	2: 135,939,983	Q241H	probably benign	Het
Plpp6	A	G	19: 28,964,320	D107G	probably damaging	Het
Ppp6r2	T	A	15: 89,275,487	L459Q	probably damaging	Het
Prss55	A	T	14: 64,075,722	W238R	probably damaging	Het
Rgl1	C	T	1: 152,536,281	E446K	probably damaging	Het
Ric3	C	T	7: 109,038,883	G221D	probably damaging	Het
Rnf167	T	C	11: 70,649,303	F83S	probably damaging	Het
Ryr1	C	T	7: 29,098,777	V947M	probably damaging	Het
Scn1a	A	G	2: 66,288,968	L1397P	probably benign	Het
Sh3bp1	T	A	15: 78,918,319	V251E	possibly damaging	Het
Slc25a10	A	T	11: 120,497,074	I198L	probably benign	Het
Smoc2	A	T	17: 14,368,971	N234I	possibly damaging	Het
Spdl1	T	A	11: 34,819,309	K382*	probably null	Het
Ssrp1	G	A	2: 85,042,316		probably null	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Triqk	T	A	4: 12,974,817		probably null	Het
Ttc19	T	C	11: 62,283,693	Y128H	probably damaging	Het
Vmn1r15	T	C	6: 57,258,692	S182P	possibly damaging	Het
Vmn1r226	A	G	17: 20,688,213	I236V	probably damaging	Het
Vmn2r120	A	C	17: 57,509,479	N625K	probably damaging	Het
Vmn2r78	T	C	7: 86,920,154	I85T	probably damaging	Het
Wdr60	A	T	12: 116,229,571		probably null	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt7a	C	T	6: 91,394,486	V165I	probably benign	Het
Zbtb40	A	T	4: 136,985,017	Y1127N	possibly damaging	Het
Zfyve1	A	T	12: 83,547,931	H762Q	probably damaging	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1670:Cspg4	UTSW	9	56897403	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3830:Cspg4	UTSW	9	56897621	missense	probably damaging	0.99
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4545:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5726:Cspg4	UTSW	9	56885904	missense	probably damaging	1.00
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6343:Cspg4	UTSW	9	56892692	missense	probably benign
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R6981:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
R7809:Cspg4	UTSW	9	56890190	missense	probably damaging	1.00
R7940:Cspg4	UTSW	9	56888097	nonsense	probably null
R8078:Cspg4	UTSW	9	56890259	missense	possibly damaging	0.57
R8082:Cspg4	UTSW	9	56885893	missense	probably damaging	1.00
R8217:Cspg4	UTSW	9	56890353	missense	possibly damaging	0.53
R8237:Cspg4	UTSW	9	56892680	missense	probably damaging	1.00
R8353:Cspg4	UTSW	9	56898669	missense	probably damaging	1.00
R8372:Cspg4	UTSW	9	56887195	missense	probably damaging	1.00
R8691:Cspg4	UTSW	9	56892996	missense	probably benign
R8720:Cspg4	UTSW	9	56887513	missense	probably benign	0.25
R8907:Cspg4	UTSW	9	56883683	missense	probably damaging	1.00
R9063:Cspg4	UTSW	9	56888403	missense	probably benign	0.03
R9115:Cspg4	UTSW	9	56890452	missense	probably damaging	1.00
R9152:Cspg4	UTSW	9	56888179	missense	probably benign	0.26
R9154:Cspg4	UTSW	9	56891003	missense
R9361:Cspg4	UTSW	9	56896593	missense	probably damaging	1.00
R9574:Cspg4	UTSW	9	56890058	missense	probably damaging	1.00
R9608:Cspg4	UTSW	9	56885552	missense	probably benign
R9685:Cspg4	UTSW	9	56890338	missense	probably benign	0.05
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTGTTCTCACACAGAGG -3'
(R):5'- GTTCACCAAGACCTCCTCTG -3'

Sequencing Primer
(F):5'- TACCTTGAGGGGAGGGAGCTAC -3'
(R):5'- GCACTTCCTTGCTGGGCATG -3'

Posted On

2014-10-30